Description :
From Genome Similarity Track
Location :
Scaffold_48:47578- 51230
Transcript NameFunction/comments
Physo_136733retrotransposon protein, putative, unclassified
Physo_136734hypothetical protein

Sequence
3652 bases(100 bases per row)
TGTCGTGAGTGCCGATGTACTGGGGTTCGACGAGGCCTTTTGCAGCATAATCGCGGAGAAACTTGATCCGGATGTCGATATGCTTAACACGGCCAGAGCT
TGCTTCATTCTTGACTTGTAGTATCGCGGCTTGATTGTCCATGAGAAGCTTGGTCGGAAGCTGGACCTCAGCGCCAAGCTCACCTAGAAGTTCCTTCAGG
CCCAACAGCTCCTGCCCACCTGCTGATGCAGCCACGAATTCAGCTTCTGCCGTAGAAAGAGCGACGGAGCTTTGTTTCTTGCACATCAACCCCACGACCA
TGCCATTCATACAGAGAACTGCACCACTGACCGACTTTCGGTCCACCCTGTCGCCGCCAAAATCAGCATCCGTGTAACACACCAGCTCGATCGCCGAAGT
GGTCGGGTGATCCTTGACCATGTGGAATCTTAAATCCAAGGTGCCAGCCAGGTATCGCGCGATCCGCTTGTCCAATTTCCAATCCTGCAAGGTGGGTGCA
TGAGTGCGCCGCGTTGCACGGTGAACTGCAAAGCCGATGTCGGGGCGCGTGCATCTCGCGATCCAGAGTAGCGCTCCGACCAACGACTGGAACATCTTGA
TCGTCGGCACCGACGGGTCCGAGCGTGTAGGCGACTCGGGGAGCAGCTCGTCCGTAGTGATGGGTACATTCTGGTCTTCTCCAATCGGGCACCGGGCTGG
GTGAGCTTGAGCTAGTCCATGCTTCTGCAGCAGTTCTTCGATTGCGTGCTTTTGTCCAAACGGATAGCCCGACTTGTCGTCGTACTCAATGTTCACACCG
AGAAACATCGTCGCCGGCCCTAAGTCTTTTAGGGAGAGCACTTGTATGTCCGCGAAGAATGCGTCCACACGCTCCGTCGACGTCCCTGTCACGAGAAGAT
CGTCGACATACGTCCCCACGAGTGTTGTGCCGGAGCGGTCCGCCTTGAAGTACAGGCAGCTGTCCGTGACGCACTGCGTGAACCCGTTTTGAAGCAGTGT
CCGGTGCAGTAACTGATGCCACTGTCTTCCTGCTTGTTTTAGTCCGTAGAGGCTGCGGTCAAGGCGCAGTCCCAGCTCTTTCACGTCGTTAGCCCCGAGT
TCGGCGAGCGTTTCCTTGCTGATGTCCATGCCTTTCGGGATCACAAGCACGATCTCAATGCCATCTTCCGTCATCGCCTTCACATAGGCGTTAGGAACAT
CCCCGTGGCACGCTCGTACCCCCCAGATCCTGGCGAGCGCGAAAATCACTTTGCCACTGGTCATCTCAAGGACGGCTGCGAAGGTCAGAGTATAGTTGAC
GCCGAGTACTTGTTCATTCCCGCAAGCCACGAGGCGAGCTTTGTAGCGCTCGACAGCCCCGCTCGAGTCCCGTTTCTTCTTATACACCCATTTTGCGTGA
AGCTTCGGCGTGTTAGGTTCGCACTTGATTAGCGTCCACGTTGCGTTGGCGATCAACGCCGCGAGCTCCTCCAGTTCGGCGGCTGTCCATTGTGCTGCAT
CCGCGCTCCGATGAGCTTCCTGGCAGTTCTTAGGGTCCGGCAAGGACTCGCTAGCAGCGAATGCGGTATTGACCGGTGCGTCAGGGCTGCTTGAGCAATT
CGAGCCTCCTCCAGACGCTGACTGGGCAGACATGCATGGTCCTCCTTTCGCGTCGTCAGCTTCGCGCTGCTTCCGAGACTTGCGACGCTTCCTAGTTGAG
CGTCGTTGCGCGGGCTTCGCTGCTTCCGGCACCGGCGGTGGGTTCTTTGCAGGCAGTGCTGGCTTCACAGGTCCCGGTAGGCTCGTCGCGGCAGATGCCT
CCTTGGCGTCAATTACGTGAATTGGGCGGTCTTCGTGCTGCGCGATACGACGACGACGTGCTCAGTTGGCAGATACACGCGGTATCCCTTTGTCTCACTG
TCTTTGCCAATGACTCGCCCAACCACCGCGCGCTTCTGTAGTGGCTTCTTCTTTGGATCCCGCCGCACCGTGCACGACGCTCCAAACGCCACCACATCAC
GAAGTCCAGGTGATTTGCCGGTGATAACCTCGAGCGGCGACTTTCGGTCTTCGTTTGACCTTGATGAGCTACGATTCAGGATATACGTAGCGTATTCAGC
CGCGTCACTCCAGAAACTTGTTGGCAGGGCCGAATCAAAGATCATGCACCGCACCATATTGAAGATGGTACGATGCATGCGTTCTGCTTTGCCGTTCGAG
GCTTGATTGGAGGCCTCGCTCACTTGTCGGGAGACGCCTTCGTCCTTGCAGAACAGGTCGACCGTTCTGTACTCTCCTCCTCCGTCGGTCCGCAGGACAT
GGATCTTACAAGAGAATCGCTTCTCAAAGAAAGTTAGAAAGTCGCGAAACTTCCTCGCAGCCTCATCCTTGGTCTTGGCCGCAAACACGCGGCAGTAGTT
GCTGCGGTGGTCAATAAAGTTAACCAAGTAGTGATTGCCGTGTCGGTCCCTCGGTGTCAGCGGGCCCTTCAAGTCGCTGCAGATGACGCCTCCGACGCGC
TCGGTTGGCGCGTTCTCCCCGCTGTCCGCCTTCGACTGGCGCCGCTTCGATTGCTTCCCCTCCGCACAGACCACACACCTCTTCCTCGTGTGGTCAGTGA
GATATATTCCGGAGTGTGGGTCACGGGCGATCCTCTCCACCGTGTCCAGCGCCAAATGGCCGAAACGCTCGTGGAAATACATGAGCGATCCACGCTCCAC
GTCGTCCTCTACCGCCGGCGACATCACTGCGCTCATCGCCAAGGCGATGCCTGCGTGCGGCGTTGGCCGAACTGCGGCCAAGTCAGCGATCAGGACGTCG
TGCTTAAACCGTACTCGGAAGACCGTTTCGCCACCGGTGGCGATCACGAGGCTCCCGTCCTTCTCTGCCAGAGCACATCCACGCTTGGCCAGTTGTCCCA
AAGACAGTAAATTGCGAGTGAGCGTTGGCGCGTGGTAGACATTGCTGACGGTAATGAGAGCGGCAGCATCGCTGTCTCCTCCACGAAATATGACTGTCCC
GACTTTCGTAACCTGCAGCCCATTTCCGTCTGGCTGCGTGAGCGGCTCGGTCCCGGCGCAGTCCTTCGCGTCGCGCAGCACGCTCGCATCATTCACATCG
CTCCGCTGTCCACGATCCAGCCCTCGTCCTTGCTTGGGCCTCCAGTGGCTGCGAGCGCCCAGCCCTTCGGCTTCCCCCCTTCAGTCTTCTTTTGACGCTT
TGGGTGTGGGCACATGCGGGCAATGTGCCCAGTCTTCCCGCAGTTGTAGCACCTTCCCGGCTTCCTTCTGGTTCATGGCGTCCGTATCAAAACGTTGCGC
AAACTGCACTAACTCTTGAGCATGCAGCATCAGGTCCGGCCGAGTCTCATCGTACCTTCCAAGCAGGGTCGGGCTGAATCTCGGCGACGCGTGGCGAATG
ATGTTCTGCAGGACCATCGCCGGCGAAGCGTCCGTTGCTCGCATCAGAGCAGTCAGATAGAGAAAGTGGTCGTTCCACGACCGGCCCGAGTCCTTGGGCG
CCGTGAACATTACGGCCGCGTTTTGCATGGACAAGCGTACCATGAACTTCGCGTTCATCTGCTCCAATGCGTAGAACAGGAACGGGCAGATCGTCCACCA
CGTGTTCGCCTGCTCACGGAAGAACCTTCCAGGCTTCCCGACAAGGTGCTGC