Description :
From Genome Similarity Track
Location :
Scaffold_816:4757- 7957
Transcript NameFunction/comments
Pytir_DAOMBR486snap_masked-pir_contig_816-abinit-gene-0.10P-type ATPase (P-ATPase) Superfamily

Sequence
3200 bases(100 bases per row)
ACTCGGCCACCTTGTCCCAGTTGTTCCCGTGACAACGGAACGCTTCATCAAAAGCCGCTTTCTCTTCGCTCAACCACATGCCGTGNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNTAGTCGTCGGATGGTCCATCTTCTGCTCGCCCATTTTCACGGAGCTGCTGCTCTTGTTGCCGATAAACTTGTCGCTGGTGA
GAATCAACGGCATCTTTGCAATCTTGGCACGCGCTGCTGGTGGTGCTGTTACTGAGGGCTGCGCTTGTGGCTGCGCTTGGGCTCGCTCCCTCTTCGCAGG
CGCTTTCTTCTTCGCTGTCGTCGGCTTAGACCACTGCTTCAGTTGACTTTGTTGCTGCTGTGACTGCTGCTGCCACTGCTGTTGCCACTGCTGCTGCAGC
TGATACTGTGATGGGGATTGCGTTGGCGGTGGTTGCAGCTGCTGATACTGCTGTCGCGCTCTTGCGCCACTGTCTGCGTGTGGGCCGTCGTTGATCAGGT
CCGACCGCTGGACGTCGAGCGGCCACCGAACGTCCGTACCCATCCCCATTCTTCCTCCATCACCAGCAGCAGCAGCCGGGACCGTGCCGCCGTTGTATTG
ATGGCGCACATCACCTCGCATCGGAACAGCCGAATCCATCTCAGCGCTGTTCCACCACGCCAAGCCGCACTCTCGCTGCTGCTGCTCTTGCTCTGAAGCA
ACGCTAGCAAAAGCACCTACAAACTCGACGTCCACCTCGTTGCTTTCTGGATCTGCGTTGAGAATGCTTGTGATACGCATCGTGGGCGTCGTCGCCACTG
GCGCACTGGTGTCTGGCTGCCATTGCTGCTGCTGCTGCTGCTGCTGGTTGTAATGGCCTAGTGATGGCGCGTGCGAGTGAAGGGTCTGCGCGTGGATACG
GATGTGCTGCTGCGGTGGGTGTGGATGCTGCTGCGCCGCCTCGACGCTCTGCGCGGCCGCTGTGAGCGCGTCCATCGTGTCGCTTTCGCCCTCTGTTGGC
TGCTTGCAGCGGTGGCTTTCCAATGTAAATGGCCACACAAAAAGGAGAGAAGCGCGCGCAAAGTACGCCACATAGCGCAATAAAGCACAAATGAAAATAA
CGCAATAAAACTGCGCTTTTGAGAAGTGTTGTTATTGCGTTATCCTCAGCATTGTGTGTCGGACACTGGAACCATTACATTTTATTTGAGCGATTGCAAT
TGTCGATACCAGTATTAACGTCAGACAGTTTCTGTTCATGTTGCCAACATGTTCATGGCACACAGTGCAAACTTTGGCAGCAGGTCGAAGCATGCCAACC
ATGGACGCTGTGTCCACTTTCGAATTTATATACGTACGTAGTATTGAAGATTGAAATTAGTTGTTTCGCGCACCAAAACTGTGTCATCTCCTCTCTTGCT
ACAACACTTCAGTTTCCTCAGGCTCTCTTCTTTGCTTTCGCGTCTGCTGCTTGGTTCAAAAGTACACAATCAAATAGGAAGGTGGTTGCAGCAACGTACA
CTCACTCTTGCAGCACAGCACTCGTTCGTTCGTTCATTCCCTTTGGTCCCTCCTTTTTCACCCCTTCCTCATCTGTCTGTCTACACAAAAAGTCCGGGGG
TTGTGTGCGACGGGCGCGAGCCGTCCGTGACCGAGGCGCTCGTCCCATTGACATTGCCTCCACCGCCACCGCCACCGCCACTGTCGCTAAAATCCGACGA
CCGCGAGTCCTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCGACGCCATGCTGTGCGTGGAAAT
GTACGACTCAGCCATGGCGGTATCCGGGTCGTAGCTGTACGCGAACCCGCTCGAGCTCGAAATGCGCTGCTTGCGCTTCTGGCTTTGTGCAGCGGCGTGC
TGGAAGAATAAAGAGAAGTAAAGAAAGATACATCAGTCAGTACCAAGCGAAGAAACAACATGAGAGCAGCACACATATACGACATACCTCAGCCTGTTGT
CGCTCGGTTGCGCGGGTCGGCGACGCGGCCGTGAAGTAGTTGGCCGAGTCCTCCTCCTGCATGCCGTTCATCATCGGAATGCCAGCCTCCAGATTGATGT
GTGACGGAGACAGCGGCTGCGCGTGGCCATGGGCCTTGCCCAAGTTGAGCGTGTAGTACTCCTGCACGATCTGCCACGGCAGCGGGTAGAATCGGCGCTG
GATCGCTGTCCACGCAAAGTGGCGCAGCAAGCACACGATGCAGCAAATCGGGATCACGAGCCAGTAGCTGCCATCACCCAGTGTGTTCTGGAAGCTGCCG
TAGTCCAGCGACGAGAGCGTCACGAACGAGCTCGACACGATGATCGTCACCGGCAAGTACGAGAGCACGCCGAGGAACCAGAGAATGCCGCCGTACACAC
TCCACGACATCTGCAGCATGATCAACTTCATGTTCGCGACCAGCACCACGCACGTGAACGACAGCAAGCCATACTGCACCAGCGGCGCGCTGCCCTGGTT
CGACGTGTCGTCGTTGAATGCGAACACCGTGAAGATGTAGATCACAATCCCTTCATACACTGCACTGCAGATCCATTTGAAGAACGTGTAGTTGTTGAAC
AGCTCCATGCGCGGCCCCACGTGGTAGAGCTGCGGGAAGTGACGCCCCACGCTCCACGGCACGTCGTAGTCGAACACGCCCAGCACGATGATCGGCAGCG
ACGTATATGCAAGGTTGTACATCTGGAAAGCGACTTCGCTGTAGAACTTTTGACCCGACGCACTCGAGCTCACCATGTAGAAGTACTGCGCGAGCACCAT
CAATATGTTTTTGTAAAACATGTACCCGGCCAGGATCGACATGCGCTTGTAATTCAGGCGGCCGTGGTGCAGCAACAGCTTCTCCAAGAAGTAGAACTGG
CCGATCGCGTAGTCGCTCGAGTTCACTGCCTGCATGCCTTCCATGCCGCAGATACCAACGCCCACGTGAGCGCGCTGGATCATCGCAACGTCGTTTGCAC
CATCCCCGATCGCCAGCGTGCGCGCGGTCTTGTTCGTCATGCGCACAAGCGTCACCACTTCAGCCTTCTGACTGGGAGAGACACGGCAGCAGACCACACC
TTCGCAGCTCATGGCGAGCTTCAAGAACTCCTCGCGGCATCGATCGTCTGCCAGCGTCACTTCTAAGCATTCGCCATCGATCACCACGGCTTGACGGGAC