Description :
From Genome Similarity Track
Location :
Scaffold_1225:4757- 6870
Transcript NameFunction/comments
Phypl_g12816hypothetical protein

Sequence
2113 bases(100 bases per row)
ACAAGGCGCGCATTGAGGAAGGCAACGTGGCCATCAAAGATCATGGAAACAAGCAGAGCAAGAACGCCTCGCAAGTCGATCATGTGTGGCTGGTGAAGTG
GTTCCAGTCGATTGCGGAAGAGGTAGGCAAGGTGATGCCTGTACGTGTTCGGATGCAGACAAAACGTGACGGTACCGTTCAGAAGTACTATAGCAACGAA
ATGTACACACTTTTGCCGGCGCACGTCACGTAGGACGCCATctacgacgagatgcacAAGTTTGTGGAGTCTGGATTGAAGGTGCGAGAGCCGGCTAAAT
CCACAATGCGCAAACTTCTGACGCTGCATTGTCCTACCATTCGGATCCACTCGCCACGTAGCAATGTGTGCGATGACTGCTCGATCTACTACGCATCATT
GCGGGGCAGCTTACTGCAGACAAGACAGAGGCGTTTGGACATCACACGGAATCAGCTCGATGTATGCGGCGAGTTTGTATGGGGAGATTGGTAACATTTT
GATCTATCAGATACATTTAACCTTAGATATTAATAACGTTTTGTTTTATATGGCAGCCGCGAGTACCAGAACGACAAGCTCTCCATTACAGATTACCACG
CTGTGACCATGATGGATTACTCGTAGAATTTGATGATTCCCAGCGTGGCAAACACGCCATCTCAGTGGTACTTCTGCTCGCTAGTCTCCGTGAGCTGCTT
TAGCATCTTCTACGAGAACGATGGTCAGCAAACAAACCACCTCTACGACGAAACGCCAAGCGGCAACCGCAGCGCCAAATAAACTCAACGCTTGCCCATT
TCATTATGACCACCGTGGTCGCGTCGGCGAAGACCCGGCTGACGGTGTATGCGGACAATTGTCCGGGGGGAAACAAAAACAACCACGTCATTAAGTTTTT
ACTGGCACAGGTAGACATGGGCGTCCTACAGCGCGTCGACTACAAATACTTTGTGAAGGGCCACACAAAGAACGCGTGTGATCACGGCTTCGGTCACGCG
CGCAAACATTTGGCTTCTGTCGATTGCTGGACCATGGATCATATTGTCGAGGCCGTCAACGAAGCtaccaccagctccatcatgGTGCATATTCCGTGCG
GAAGCGACCTGTTCAAGTCGTACAGAGGTCCACTGACAGAGCTCTACAAAAAACTGGGCGGAATCCAGCAATTTCAGATCTTTTCAATGGAGGCTGCTAA
ACCGGGGGTCGTCGTGAAGCGTAAGAACGGGCCGGATTCTGTTGCAGAAGACAAGGACCTGCGCCCGAAGATTGACGGTATTCTGACTGCAAAGCCAAAG
GTGCTGCGTATAATGACAGATCACGTCGAAGTGCTGCCGCCCCCACTACCCAACGCAGAAAAAGTCGCCCAAATGTACCACAGCATTCGTCCCTACGCCC
CTAAAGGATAAAGAACGACCCGTCGTATGCGAAGGCTAgcgaccaagaagaacaagatgCGAAGGCAGTGAAacaagcgcgacgtgcacACCGCGTTGCG
ATGGCTAAAACACCGAAAGGGAACCAAGACCAGCGTGGGCGAGTCAAGAGCGCAACTGAGTCAGCATCCGCTCCTACGAAGACGACACCAGAACCAGCGA
AGAAaaagcggcagcagctaAGCAGGATCGTGGTATCGCGAAGAAGCAAAAGGCAGCGGAGTGCGAGACTTCAGAGGAGTAGACTGAATGTCGCGGTATC
CCAAAATTTATTAGGCAATCATCTTGATACTCATGTCCATGAGCTAATCAAAATGTTACCACTCTCCATTTGTCAAAATTCAGAAACAAAATCAAAATAT
ACCCCATGGATTCGGAAAGGCAGCACTAAAAATCGGTTTTCACACAGTTACACGACGAATTAGCTCAGTCGAAGGCCATTACCGGCTTCCTCACCCGATT
TAACACACGATTCGCCAATAAACAAAAATCAACGTTTCAACGCAATCATGGAGACAACTTTTTCAACGGGCTCGTACTCAGTGTCATATACCTCAAATGA
GCTGCAGAGGGTCTCAATCAAAAGAGGAGAGCATCTGCTTTTCAATGGTGTACCCAAATCGCGATTCGCACTTAGGCTTGTTTGAACAATTCGTTTGACG
CCGTCTCATATAT