Description :
From Genome Similarity Track
Location :
Scaffold_171:47564- 49804
Sequence
2240 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCACAAACCACACTTGATTTGGTGACTTCTTCACTAACATCAGTAGAGTTGG
TGACTTCTTCACTAACATCAAGAGAGCTGGTGACTTCTTCACTAACAAGAGGAGAGTTGGTGACTTGCTCACCAATTTGAGGAGAGTTGGTGACTTGCTC
ATGTGGTGTAGTAGAACACACAAATATCGTCAGATGTGGATTCCTTACACAAACCACAACGAATCGCCGAGTTAGGTCGGCGGTTTGTATGGCCTGCGCA
GAGGGTGGTCCCCTCGCGGTCCGGCCCTTCCGGGACAGACGAGTGGCTCGTTTCCACTCGGTTCCGACTAACCAAGTCAGATCACTTCCGAGACTCCGCC
GAGTTTGGTTCGGCTGAGCTCGTTCACAACCCTGTGCCCTCCACCAAAGGATGGACGACGGCGCGCGAGCGCTTTTACAGGTCACCGAGCGCAGAGGCTG
CTCAGCTAGAAGTGTTACGGCACCCGGGCTATCCGACGTACCGGCTCGCTGAGTATGCGGGACTTTCTTTCGCGCGTAGCGAGACTTTGTCCTACCCGGA
CCGACCTAATCTCTTGGCGCTACCAGTCAATACTCTACAAGCTATGCCTCTCGAGTATTGACGGCAGGCATAATCCAGCCCTATGCAGGGACTTACCGGA
AAAGTGTACACTTGTCTTGGACTAGGAAAATTCTGCTCTGTTATCTTCTGGGAGCCTTTTCGGCTCCTCCTATTTAATCCTATGCTTCTCATACAAATAT
CTAGTGAAATGTAGTCGTTTCGGATCTCTACCGACTCTTCAGGCGGCCGTTGAGCTCAGCGGCTATCCGGATAGCATATCCGGACAGATCGCCGAGTACT
TACCGTGATCCTTGGCTCCTAAGCTCTGGGTTATCAGACCGAGCCGATTCTTGACCTAAAGTAGGTCGGCGTATGGTCGAATCTGGAAATCCCTACACCA
CTTATCCAACCCAAGGTTGATTTCCTATCGCACGAGATTACGCCAAGTGGCATACGCGCTGATGCGAAGAAGATAGCCGCGATCGCCGAGCTCGCCTTCC
CGAAATCGAAGAAGGGAATGCAAGCGTTCCTCGGTGCCCTCAACTACTACGGCCGATTCATCCAGAACTTGGCTGTTTACGGAGCAGTACTCTATCAGCT
AAAGGATACGGACTTTGAACCTGGGGGTGACCTGGCGTCAGCAAAAGCATCATTCCGCGAGCTCAAAAGACGGGTAGCAGAAGTTCCATTTGGCTTCATT
TGGGATCTGCGAGCGAAAGAAATTCACCCTATATGTTGTTAGCCACATGGAGTGAGGCGCTGGAGACATTAACTTGGATGCAACCACAGGAAGAACAAGC
TGGCACCCAGTTTGGCTTCTGCGGAGCGCGATTTATAGAGAGAGAGAGATACTCGGCTATCATCCCGCTGAGAACGAAGTGGTCGCGCTGTTGCAATTGC
TGACAGTGTGCTACACTCTCTTGGCGGGAAAGACGCTTCACGTCTACACCCGTTTCTCCACGCTGGAGTGGGTGTTTAAGTCAAAGTCGCTGTACGGTCG
CGCAGTCAGTTTCGCAGTTATGTTGTCGCCTTACGATTTGAAGGTGAAGCGAGTACGTGAGCGAGATGTAGACTTCGCCCAGTTGCTCCAGGCGTCGATA
ACCCCGTTTATCGGACTCGACGATTCCTTGAAGCACCTGGCGCCTCCCTCCAAGAACTCGGCGACAGTTCGAATGGACCCAGCGCTGCTATATGCCCGAA
TACCAGCTGACTTTGCAGGATGCGTGCTGTCATTTGATGGCTCAGCGAAGACGGCTAAATACGGCGGGTATGGCAGTTGTTCGTGGATACTATGGCGCCT
CCCGAATTGGGACATTGAGATTGCTGCGAGTGCGTACCTGTCGTCCACCACAGTCAACATCGCCGAGTACACCGGCATGAACAATGGAGTCTTGGCGGCG
ATTGACCGAGGGATAACCGATCTGATTATCGTGGGTGACTCCCGGCTTGCAATCCAGCAATCCATGGGGGTGATAGCATGCAAGAAGGAAACGTTGCAAG
TGGAGCTAGCTCGACACAAGGATCTCACGAAGCAACTCAACTCGGTCCGGTATCGACACATAGCGCGACACTATAACGCAGCGGCTGATTCTCTCGCTAC
AGAAGCACTGGAAGCTAAAGCTGGACGAGTAATTCTCGGG