Description :
From Genome Similarity Track
Location :
Scaffold_158:47558- 49174
Transcript NameFunction/comments
Hyaar_Emoy2811462hypothetical protein

Sequence
1616 bases(100 bases per row)
CTAGCTGACTTGTGGCTTGTACCTTCAGAGCCACGGTCAACCAAGGATAACATCAAATATGTCATCCAGGTCAAAAACGATGAAGTCATCGTTATATTGG
ACTTCCTTCAGTGTATAGGAAATCCCTACCATACGTTCCATCACTGTTACGGATGCGCCTGTCGCGAGACGTACCGTCATCCTCGTTGGAGGGATATCGA
GCTCAATAGTTTGAGCTTCAAGTCATCTAGCGACTGGCGTCGCTCAAAGTTGTTCGACGCCCCACAGTCGACTAGCGCTCGTAGTGACGTGTCCTTTGCC
ACTTCGAGTTTCAATGTAATGAGAGAACCCTCATTAAAAGGTGCAGTAATACATAATGATTGCGTGTTGGGAGCAACTTTCGTCAAGAGGCCTGCAAATT
CACTTGACGTTGCTGGATCAGTAGGGTGCTCCGCACCTACTGACCCTGACCATTTTTGACTGTCCGTAATGTTGCGTTTTCGCAACAGCGTCGGACCCAC
GCCTCGGCCCCCTCTTGGCCGCTCGACGGTTACTGTTTTCTGCGTTACGTGGTACCGCGTTCGGGGCACTTCATTCGTATGCGTAATGCCCTGTCTTTTG
ACATCTATTGCATGCCTACAATTTCATATAATTGGTAACATGAGAGCTTTCACCCTTAGCATAACAGAGTTTCATCAGTCCTGGGCCTCCATTTCCTGTC
GCCATGGGGAAGATAGGAATTCATATTACGTGAGCTTGTTTCACGCTGAAATCCTTCTCTTCCAGAACCAGGATTGCCTTTTCAAGGGTATCGAATTCCA
GTCGGAATAGCTAGGATTTGACTGGACCGTCCGTGAGACCCTGCGTGAACAACGTAATCAACGTTTATTCATCTGGCGGATTTGCTGTAATGAAACTCGT
AAGATAACGTATGTACTGAATGTATGAGTGTACATCATGTTTGCCTTGTTTGATTTTCAGGAGTTCATAGGGAGCCCTGAACTTGGCTCGCGGCGGCTCA
AACGTTTGTCTGATTCGGGATGTAAGGACCTCTAAGGATCCAAAGACATATGGATCTTGTAGTTTTAGACCCAAGACCCAACACCCAAGGCTTCGCACGT
CCTGCCATGTCCGACTGAGTAAATGCGACCTGCATTTGTTCATCGACGATGTGACTAGCCCTTATTGCGTCATCTAGCTCAACAACCATCTAAGCAGAGA
GCCTTCTTCAGCCGCTTTGTATTTAGAGATGTCGATCTTCGGTGATTCGGGTCGACGTGAGTGCGTCGACCTAGTGGCAGCAGCCTACTGCTGTCTCTTA
AACTCGAACTGTTGAGCACTATGGTCTCTTAACAGCTCTGCCTGTTGACACCCTTGTTGGTGAAGCAAGGCTACCTTTTCCCGTTCAGCGTCAAGTTCAT
TATGAATGAACTTGGCGATGGTGGCGTGTTGCCCGTCTGGACCCATTGCTCCTACAGTTTCTTGCCCTATCATCGAACTAAACCGTTCGACAGCATCCCA
TTAGATTTGACTCAAATGGGAGTAGCTCTCGTGCGTTGGATGGAAGTCTTCCGCTTCATCATCTTACATGTTCATAGTCGTTGGACGGACTACAAAGTGC
TGCCAGGTGTAACGGG