Description :
From Genome Similarity Track
Location :
scaffold_7:47543- 49092
Transcript NameFunction/comments
g8408.t1hypothetical protein

Sequence
1549 bases(100 bases per row)
GACAGCTCGCATTTTCTGGGTGCTGTGGACGCAAGAAAAGAAGTTATGGCATGGCCTCTCATCGCTAAGCAGGGAGAGAAATGAGGCAGTTGGCAGATCG
TTGACGCTTTCCTCGACGGATCATTATTATCAAGAGGCGAAAGTTTGATTATGAATCTCCGTCATTAGCATAATTGTTGATTGTTGATGGTGCCATGTAC
ACGTTTGTTGTGATGAACGACGCCAGTAGGAGATTGCGTGAAATTCGATAGGCGACACGGACTTCAATCGTTTACAATTTGATGAACTCGGAGATGTGCG
AGTGCTGCTGTGATTCCTGGCCCTTGGACTGGTGCATCATGGGCAGTCGCTGCAGCTTGATGCAGCGCAAATGTGCTTCCAGTTTCGGTTGGAAGAGATT
AAGAGCTCCTGTCAGTGTGTCGATGTCACTCGGGCCTATCAGTGAGTTTCCACTGAGCAGGAGCTCCTCCAACGTAGCGTTCCCTGTTGCAAATTGGACA
CCATCGACCATCTCTAGCACGGGTAGACCAAGTTGTGCGATGGCTGTGGCTCGATCAATCTTCTTTTTGGCCTTCTTCGCATGGTCCATCTGAACAATTG
CAACCCGAATGAGAATGTTTAAATGGTACAGGCCAGCGGGGTTTGGTTCCTAGCGTACCTGAGCATGGATTTGACCCTCGGCAGCGTCGAGCTCTGCCAA
AAGCTCTGGTGGTGCTACGTATTTTGTAAGTCCATCAACCAACAACTTCGCTCTAAGCAGCAGCACAAATCGTGGTAAGTAAACCAGGATCAAAAGCATG
GGTCTCTGGAGGTTTGGCAACTTACCCGCGCCCGGAGATCTTGTTGTTTGCGAGTGAGAGTGTCTTGAGTGTCGAGTTGAACGGCAAAGCATGTGCGAAG
GCCCGCGCTCCAGCATCGCCGATAGAGTTCTGAAAGAGATTGAGAGCTTCAAGTGTCTTGCTGTGGCGAACTGCTCGAGCCAGCGCTACTGCTCCCCGTG
AGGTTATTCCATTCGCACGCAGCGATAGAAAAGAGAGCGCTGATTCCTCGCTTAGTAACTGGGCAAATACTTCCGACGTGTCGTCCTCGCCTCCAGTTTC
CAGCTCCTGTTTCATACTGAGTTCATGTCTTTGATCCTCACTCAACTCTTTTTCTTGGTGTGCTTGATCTCTCACTTGCGGTACTGTTGGGTGTTGTTTG
CTGGTAGCACCACCCGAAGGAGGTCTAGAAGTTGTCGGAGGAGCTGAGGGTGGCCGGGAATCTCCACCAGAAGGTTGAGGAGACTTGACACTTGGAACTG
GAGACTCCGAAACACTTGAGGTGCTGGTGGGGGCAGAGTCGAGTGGGTTCCATTCCAGTTGAAGAGCGGTCACGTGCGTCCTCGGAATCGTACAGCATAA
TAATGCTAGCTGCTCCTTGTTCAACCCGACATTAAAGAGGCTAGGCATTGACGCTGGTCAGTGCATACGAAGCACTAAAAGATGCACGTGACGTACCAAA
CAGAGCGAACTTTGGTGGAGAGCGGGAGTGCGAAGCACAATGCGCGGCA