Description :
From Genome Similarity Track
Location :
Scaffold_182:47530- 48533
Sequence
1003 bases(100 bases per row)
CCAGATCCGGCAGGTAGCCTAGACGAACATCCATGTCCAGATCAAGATCAGAATCTGTGGGGTGTAGATTGGGGAAGTGATGGCGCACCTGGATCAAGCG
CCACAGAGATAGCAGATGCTTTGGAAACCGAGCCGACCAGATCGGGATCTGAACCCACAGTAAGTTTTGCCCAGATCGCGATCTGGCTCGACAATCTCGA
TCTCGGATCTCGGATCTTGGATCTTGGATCCGTCCCGACTGTGAAGCAAGGGATGGTGAGGTATCGCAATCAGGCGATTACATCAAGGTAGCCGGTACAG
ACGACGACGGGGAGGATAGTGAGATGGCAGAAAAGACGCATAGTCAGTCGTACACCGTAGATGAGTGGATGCAGGATAGGACAAAGTATGTGATAGGACT
TAACCATAAATCAGAATCGAATTTGCCCTGAACTACAAGAGTGCTTCGCCTCCGCCAAGAAACGGGAACTACATTGGCCCTACAAGGTGTTGGCAAGTCA
AGGAGTAGCTGATCTAGTGGTTGTGTAAGTCTGGATAATATATTGGCCAGATCTTACCTACTCTAGTGATCTATTATCAAGTGCAGATCCCAGATCCGAC
GGAGTTATTACTTGGCCCGAAGATCTCTCGATTTCTCAAACCCCCAGAGCCCCCGCTATAGGAAGCGGCAAGTAACGCAAAGGAAGGAGACATCCACACC
CCAAAGGCAACCCCCGGCCCCGGATCAAGTCCAGGCCGCCAGATCAGAGCTTGATTGAATCGCTCTGGATCTGGATCCATAACCGGCAGCAGAGCGAAGA
CTTCCGCGCTGCTCCACCCCATCCCCGCGTCCCGCCAGGACGGTCAAGAAACACATAACCACATCTCTTCGGAGCGCCGAGAGAGCAGATCCAGCCCACC
AACGGGTACACAAGGTGAGAAGTTCAGCAGATCACGGATCATCGGGGGACCCCCTCCGTTAGTTGGTGTCTGGGCACTGTTGGGAAGCCGGATCCAGTCT
TAA