Description :
From Genome Similarity Track
Location :
Scaffold_48:47526- 53145
Transcript NameFunction/comments
Phymu_g2621hypothetical protein

Sequence
5619 bases(100 bases per row)
GCGTCGCTTGAAGCTCTACTCTCTCCTTCGCCGCTCCTTTGACGTGGACTCAACAGCCAAatgccacttcaacttgactGTTCGAGACGCGAACGTGAGT
TGGATAGTGGCGGTCCTGAAAACTCGCTTCATCATTTCGAAGTGCTTGTTGAAGCCCCCACAACAACGCTAAGCACAAAGGTAGTACACTGTAAGATCGC
GCGAGCCACAGTACTACAGCATGGGGGCAACTTGCTGCCGCTCATCAGTCGTAGAACTTGACATTTGAAAAGGTAGAAGCTCCGAGAGTTGCGCCTTGGT
GATGATGCTTGTAAGTGACATGATGCAACGTACATACTTAGCAATTGTTTTCAGTTAGATAGTCAACTGCATTATGTGACTCTTCAAGATCAAAACCTCC
CGAGTTCGTGGACAATGGAGCTCTCCGTTGTCACTCCACACTATGCAGATCACTCGATCCACGAGCGATTATTACTCCACTGGGTCAACTCGCTGCCGCT
TACTAAGTGTTTGCTggtcgaggagctccgagAGTTGCGCTTTGGCGACGTTTTGGTCGAAAttgtgcagtggctgcaggGAACGGAAGCAGATGACTGC
GAGGGAGTGGCAGGGGGCGATGCGCTTGACCAATTCAAAATCTTGGAGCGTCTCCGGCGAGTTGTCCAGTTCACTGCAGGCGAATGCAGGagccaagacg
gagaagcgATGTACGTAGTGAACGATGCGGAGTGTTTAGCCCGACTACTGGCAGGTGAAAGCGACGCAATTTGCGCTGTACTCGCAGTTCTGAGGAGATT
GAACCGCCAACGCAGCCaagagaacgagaacgacaaggacgcgCTTTGGAGACGTTGCGTTCAAGAACAACTGATTGAAAGCGCCTTGCATCAGGAGCAA
AAGGCTGAAAAATCGCCTCGAGAGCTGGATAACGCGAAGCCAATTAAACAAAAGCCGAAGCGTGTACGATCGGCTTCGTCCCGATCGCGACCTAACAGTA
AGTCTTTCAAAGATGCTACCGAGATGGACACTATCCATACACCACGAAATTCCAGAGTGACGAACCAATCAAAGAAGAAATCAAACCCCACCAAGAGGAG
ACTTAGCTGCAAACCGACATCGACCCCAGCAGTTGCGAGCACTAAAGACGAGAAGAAAATATCGGGCCGGAGTAGCGACGGAAACGGCGGTATGCTGGAT
GTTAGTGCTAATACCCGTGAACGTTCAAGCATTCAGGGCGTTGACGATTCTCGTGCAAAGTGCTTTTGCAACTGGGCGAGGCGTGTGCTGGGAATTGAGA
TGCCTGTCGACGAGATTTTTACCAAACAGTCAGAGATCTGGAAATTGCAGTCGCCACAGAAAATTTGGAAGACTTTTGCGAACGGCGTTCTGCTTCGTCG
TATTGCTACTGCGTTGGTTATACGCTGCGGTGAACAGCTTCAATGCAGCACCGCCGCAACTAAAGCTTTGGATTCTCCAGCTGCGAAGGATGTGCACACG
CCAACAGAAAAGCGGAGAAATTTTACTTTTGCTCTCGCTGTATTTAAAGATTTGGGGATTTCTCCTGAAGCTTTGGCTTTGTTTGAATCGATGCAGCGGA
CAATGAAAAAACCTTCAACAAAGACGATTTGGAAGGCGCTAGATGAAGTCATGAGCCAGACTGAACGGCTTTTTAGAGCTTCAAGACCCGAAGAACCGTT
GGAGACATGGGGAAGAAACGAGAACGCCTCACGGCATGTGAAAAGACTAAGTCCGAAGACTCAAGACAAAGGAAGGAAGAACATTGAAGTGGAAACTACG
GTGAATGGACTAACGGGGCGTGCTCCGTTGAATCGTAGCATGCCCTACATTACGAGTGAGCAGATGCACGTGGTGAACAAGTGGCTTATCGATGTTGGCT
TTGACAGCAAAAAGGTAGTACGAGAATAACACAACGCTGGAAGGTGAGCTCACGTGTATTTCATTTGACAGGTTCCGGGTCGTGGGGTGTTGCAAGACCC
CATGCGGAACGGCGTTTTACTCTGGTAAAGTCATTTGCCATTTACGTGATTGCCATCGACTAATTCGCAATACGTATCGGTTGCGTAGTGCACTAAGCCA
ACAAGTGACGGACGCATCATTCTCGTATTTCAAGACCCCTCGAAcgttgatggagatgagGTCGGTTGGTATCGTGAGTTTGGTGACGGAATTTATTAAC
TACTGAAGTAACTCACTATTGATTCTACGTGCAATGTATATCAGAGAAAACATTTCCAAGGCGTTTGAAAGACTGAGAGATTTAAAGACCCCACTGTGCT
ACTTAACCTCGtctgctgaacaagctgtACTCACCGGGGACAGGCAGATCATCTACGGGATTTTGTGGCATCTCTGGCAGGCCGGGACAGACAGGGAaac
ggtacatgtagtccCTTTTAAGCCTTctccgttgctgcttgatATTCCAGCTGTAGCCCTAGCGAGTGAAGGAAAATTTGCGATGAATGATCCCTACCAG
GTTGAGCTCCACGACACCTTCGCTCGGCGTCTAACTTGGAGTGAGAGTACCCGGATTAGCGACCATtacgacgacgatgacgtATTTCCAGTACCGAAGG
CACCTGTTTCTAGTCCAACCTACAGTGATGACCTCATTGGAAAACAAGTAAGGGCCGACGTTTATCCTATTCGAGCAGGTACAAGTGGTTCTGCCCAAAT
CTCAAGCCTCACTTACCAAAAGCCACCGAGTATTGCTCTTGGAGAGCTGTCAGGTGTGTATGTAGCTTTAGACAACGTGTTGTAGCCATTAAACACTTGG
GAAGTATCGCTAACATTGTTTATACAGTTGACGTTGCATCCCCGACAGAAGCTTCTAACGATCTCGCACAATTGCAAGATCGAGAGAGTTATGACAGTGT
TCATAAACCTTGTCCTGTCAAATTATCACAATCGAGGGGCAAAGCACGGCAACAACCTGTTGGGGAGATTCTAGAGTGGTTAAACCGTTTGGGAATTCGC
CTCAAAAGCATTTCAGCTTTTCACGTACGAAATTGGCATTGTCGGCTACAGTTGACACACTCAAACTTCATAGTTTCTTTCACGTTTTATTTTTTGTAGG
ACTCAAAGTCGAGCTTGACCGAATTCCAGTCCGGCGTACTGCTGTGCTGCATCAtcgagaaggtggagttCATGCGAAGTATCCCAGGCGTCACCCGTCC
ATCCGGGAAGCAGCCCCTAAGCAAAGCAAGCGCTCTGCACAACATCACCAAGGCGTTGAGTAtcctgcagcagaagaagaccatgCCCCTCCACCTACTA
CGCCGTGCAAACGCCATATACACCGGCAACCGAGACGtgatcctgcagcttctcggacAGATCCGTAAAGCGTACGGCCATCATCACGCTCCCCGTCGAC
GTCTTAAACATCATCCCTCAGCAGCATAACCCGTTCATACCATCTAAAATCTTGTAATTGGATTTGCTAGCTACAATTGGTTTGATAATGTTTCGTGTCA
TCCCTAATGGTAAAACCTGAACACAGGTTGCATTGAATAATAGTGTCCAATGACACGATGTGGTGATACCAGAACGACAAAACTTCCCCAGTAGTTAACG
CCACCTCGGTTGCTTTCATCCCTAGACGACAGCGTAAAGCCATGCTGCTTTGCTATAGCAACATTCCGAACAAAAACGATCTCCAAGTCGAGAATCACGC
TTGGTTCGATGCAGGCTCAAGAAATGTATTTCAATTCTACTTCTTTCGAGATAtcggccttcttcagcatgaagtagtacatgtagtatttgTGCGGTTT
CTCAATCGCTTCCAATTCGTAGGCATCGCCCACAGCTTTGACAAACTGTGCATACGTCATTCTGCGCGACTCAGTTTCTCGAGTGCTGTCGAGTTCAATA
GCTCCGCCAAATACTCGTCTGTCCAGCTCTCAGTAGCTGCAGAAAGACCGGCAGGTCACATTGGAACTTGTTCGCGTCTTCGTTCGGGTACTGAAGAGGG
AGAggccgctggagcttgtcGCCCTTGAGAGTCACAGCATCGTTGCCAGAGCCCCACCGTAGATTGACCGAAATGCTCCATTATTGTTTCCTACTACTTT
TTATTGCTACAACAATATATTTTATTTGGCATTTATTTTCGCAAATATTTTTGACTGCTCGTTTAAACGTATAAACAGTAGAAACTGGTGTATCCTAATT
AAACCGGACCTAATGAATTTGTGTGCATGCAAAGAGTACAAAATATGTTTAATAttcattttgtttttaatTTTCAAAAATACAACATCAATAATGATTG
CTATTTGCCAATAATTGCCCGTTCACCTTTTCGTGGCCAGCCATTTCCTATTGAGCAGTTCGCAGACCATGTCGCTGAGGAACGTGGTCAAGCGGCGAGA
GCACAAGGAGCGTGGGCAGCTGCGCGAACGGCGGAAGCTGGgcctgctggagaagcacaaggaCTATGTGAAGCGTGCGCGAGactacaacagcaagcag
aagcggctcaagacgctgcagctcaaggcggCACTGCGCAACCCGGATGAGTTCTACCACAAGATGCGcgagacgaagacggaggGCGGCGTGCACGTGT
CCACCCACAACCACATCAAGGCGGTAGACACGGAGGCTCTTCGCGTACTGAAGACGCAGGATCTGGCGTATCTGCAGATGAAACGAGCTGTGGACCTGCG
CAAGGCAGAGAAACTCAATCGCGGCCTGCACTTTGTAGACGCGCCTAAGGATAACAAGCACACAGTGtttgtggacgaagagcagcaggtggacaCTTTT
AATGTCGCTACACACTTTGACACGGCGCCAGAACTCGCAGACAGAGCGTTCAATCGTTTGAGGAAGAGGGACCTGGAGACGGCGGAGCTGCCTGATCTAG
CGGCCAACCCCAAGCAGAAGTACAAGatgcaggtggagaaggacgccATGTACAGAGAGCTGAGGGACCGACTAGCCCGCGCAAACAAAATCGGCCGGAT
GGGCGCTAAGCTCGATCTCGAACGGAAGGTGCAggccaagggcaagaaaATGAAGGTCAAGGCGGCTGAGAACGGCATGCCCGCTGTTTATCgctggaag
cagcaacgacagaaGTAGAGACGGAGGTGAAGCTTTCaccgtgaaggagctggcgtgAAAGGCTATTGATTCGCAGAGATGGCCAAAATACATAGAAACC
CTATTTCGTTACGTGTGCAGTATGTATTCCAACTGGCCGTTCTGGCTGCACTGCAATACTTAGCGGCTGTATAACATGTAGACAATACttctacacgtac
atgtagtttatGCACTATATTGCAGCACCACAACCTtggaagtacatgtattgtcCGTTTCCTACATTTTGTCCGCCTATTAGCTGGGCTTAAACGGAGC
CTGTGGATTTGCCTGTTCAACGTCTTATTCGATTGCTCTCCAGCGCAGGTCACCCGAGTACGTCATGGTTAACACGGCAAGTCTCCGAATGGCCAGGAAT
TTCTCCGCAAATGGAGGAGTAGGGCGTATTTGCTGGTCACGGGCggcagtgcagcaccagtggTTGGTCTAGCTAATCTGAGCCCTCTTAATCGTTGCCT
CGATGCCACTAACAGAAGC