Description :
From Genome Similarity Track
Location :
Scaffold_140:47516- 50411
Transcript NameFunction/comments
Albla_Nc14081470aminophospholipid translocase putative

Sequence
2895 bases(100 bases per row)
CAATGTGATTATCACATCAAAATTTACGATCTTCACATTCCTGCCGAAATTTCTGTATCAAAGCTTCACGAAAATGGCCAACTTTTTCTTTCTTGTCGTT
TGCATTTTACAATCTGTAAAAAGCATCAGTAACACTTATGGCTACCCGACCAATGCTCCCGTTTTGATCACGGTGCTAAGCATCGATGCGATTTTTGCGA
TCATGGAAGACCGACGACGGCATAAGGCCGACAAAGAAGCAAACTCAAGAAATTGCCACATTATCAAAAATGGCCAATTCGTAGACTCTCTCTGGTCGGA
AGTTCGAGTAGGCGACATCGTTCAGATCTTAAATCGAGAGATTATCCCGGCAGACGTTTTGATTCTTTCGGTGAATGAGCCTGTAGGCGAAGCCGCGAGT
GGAATCTGCTATGTGGAAACCAAAAGCTTAGATGGCGAAACCAACCTGAAGCTTCGTCAAGCTATCCCGGCCACAATGAGTTCACTTGTGAATCCTTCAG
AGCTCGTGCTTTTAAATGGAAATGTAAAATATGAAGACCCGAATCCTTACATCAGCAAGTTTACCGGGAAAATAGAGATTGCACTGAGTCAAGAATGCGG
CACAGAAGTGTCACCGATAAGTATGAAGAATATTTTACTTCGCGGATGCACATTACGAAACACGGATTGGGTTTACGGAGTGGTTCTGAACACTGGCAAC
GATACCAAAATTATGCAGAGTACGAGTGCAGCACCATTAAAACGAAGCGATTTAGTATATATGATCAACCGAATGATTCTGTGGCTGTGTGGATTCCTAC
TTTGTGCTTGCATCCTTGCTGCATTCGTCAACCGAATCTGGCAAACGAGCATTATGGGCAAGTTGTGGTACCTTCCAGTCGTAAACAATCAAAGCAACAC
AATCAGCTGGCAGCAAACCGTGCAAATGGTTTTCTACTATTTTCTGTTATTGTACCAATTGATTCCCATTTCGCTCTATGTGTCGATGACAACTGTCAAG
TTTTTGCAGGCACAATTCATTAGCTGGGATGTAGAAATGTATCATGAAGAGTCTGATACACCAGCGATTGTGCGGAGTATGGAGCTAAATGAAGAGCTCG
GACAGATATCCTATATCTTTTCGGACAAAACGGGAACTCTGACCAGGAATGTAATGGAGTTTCGTAAATGCTGCATCAATGGTGTCTCATACGGTTCCGG
AACAACTGAAGTTGGACGAGCTGCTCGTGCACGAGCACGTGAATCAGGGCAAGCAGAAAAAGACGATTTCTTTACCGAAGAAGTACCAAGCACAACACCC
TACGTCAATTTTGTTGACCCGAGCCTTTTTCAAGTACTGGAGAACAGTTATGATCCAAATCATAGAGTCCAACACGACAAGGCTGTACATTTTTTTGAGC
ATTTGGCCATTTGTCACACAGTTATTCCCGAGCGGTTAGAAACTGGCGAGATTCGTCTGTCAGCTTCATCACCCGACGAACAAGCTCTGGTTGCAGGAGC
TGGTTTCATGGGTTTCAAATTTCAAACTCGGAGTGTAGGACGCGCTGTCGTCAGCATATTGGGAAATGAGCAAGTTTTCCAAGTTTTAGAAGTGCTGGAA
TTCAATAGCACTCGAAAGCGCATGTCAGCGGTGGTCCGAAAGCCCAGCGGAGAGCTAGTTTTGTACACGAAAGGGGCAGACATGATGGTGTATCCTAGAC
TCAAACCCGATGTAGATTCAGCTTCACAGCTCGTACAAGAGAAAACCAAAGAGTATATGGAGCTTTACGCTGATGAAGGACTCCGGACACTTGCCATCGC
CTGGAAACCTCTGGATGAAGGTATGTATAAAAATTGGAAGCGGCAATACGACGAGGCGATCAGTGACATCAATGAGATGGAGCGTCGTAAAGAAGGAAAA
GCGAATGCAATCGACAATCTCATGGAAGAAATCGAGTGCGATTTAGAGCTTTTAGGGGCCACAGCAATCGAAGACAAGCTGCAAGAGGGTGTTTCAAGCT
GTCTTACCCGCTTACTTTCCGCAGGAATCAATGTATGGATGCTTACTGGTGACAAGGAAGAGACAGCTATCAACATTGGATATGCGTGCTCTCTTTTGGA
TAACAGTGTGATGCAAAGTATTTTTAATTGTACTTGCTTCCCGACGGAAGAAGCTCTTCGCAAACAACTAATTATGGTAACAAAAGAGCACAAAGAACGT
TTAGTCCAACAAGAGTCAGCTAAAATTGCACTGATCATTGACGGAGAAGCCTTGGAATTAGCTCTACGTCCTTCTACAGCCGAGCATCTCATGAACTTTG
CGCGGTATTGCAGTGTTGTCATTTGTAATCGCGTTTCGCCGGCTCAGAAAGCAGAAATGGTTCGTCTCGTCCGAGCCAATCTACCTCAAGTGCGTACTTT
AGCCATTGGTGATGGAGCAAATGATGTCGCAATGATCCAAGCCGCCCATGTGGGAATCGGTATATCCGGGCAGGAAGGCATGCAAGCTGTCAATTCCAGT
GACTACGCGATCGCACAATTTCGCTTTCTGGAGAGGCTTTTACTCGTTCACGGTCGATGGAACTATCGGCGCATTTCCAAGCTTGTATTGTACATGTTTT
ACAAGAATATCACACTCGTCATGGCCCAGTATCTGTACGGTTTTCTCTCAGGCGCGTCAGGCTCCAAGCTATATTGGGAATTCGCAGTGCAAATATACAA
CATTTTCTTCACGGGACTTCCTATTTTAGTGACCGGAGTCCTCGACCAAGACTTCCCCGCAGCGTATGGTATCAAGTATCCCGAATTATATCAACGCGGA
CTGAAGAGAATGGATTTCAATCTGTATCAGTTTTTCAGGTGGGTCAGCGCGGCAGTATTCGAGTCTGTGGTCATCTTCCTTGTCACGATCCTCGG