Description :
From Genome Similarity Track
Location :
Scaffold_540:4751- 5796
Sequence
1045 bases(100 bases per row)
GTCTGGCAAAGCCAAGACCGAAGCCTCTACAAGTGATCGCTTCACTGAAGTGAGAACATCTACTTGAGCCTCGGACCAAGTCCACTCTGCGTCCTTTTTC
AGGAGGTCAGACATTAGTTTGTTCGCTCTGCATAATTGTTGCTATATTTGTGCAAGTAATTAGCAAGCCGAATGACTTGACGCAGATCCTTCACATGTCG
TGGGACTGGCCATTCCTTAATCGCTTTAACCTTCTCTAGGTCTGCTTTAACACTGTGTTTCCCCACAATGCATCCCAGTACAGGTACTTCGGGGACCCCT
ATGACGCACTTTTGCAAGTTGACGTACAACTGGGCGTCGCCCAGAGTCTGCAACACAACGTCCAAATGACGTTTGTGTACTTCAATCTCACTCAATCCGT
CCTCTTCCCTACTATGAACAAGCACATCGTCAAATTTATGAGGCGCGTAAGCACGGTGTGGTCGAATCACGTGATCGACCACCCGGTTGAATGTCGCTGG
TGCATTTTCAAACTTTGCGGCATCACTAGCCACTCCCACAGCATACCGCTTGGGGTGCTAACTGCCGTCTTGGCTACATCGGACTCATTCATGAGTACCT
GATAGTAGCCATATTTCAATCTAATGCGGAAAATATAGTTGACTTCCCCATTGTGTTCAATAGGACATCTTTCCGCGGGACCGGTGTCTGCGCTGGGATG
GTGGCCGTGTTAAGTTTATTGTAAGCATGAACTACGCGCTAACCACCTGTTGCCTTACGCAAACAAAAGGTCGGGCTGCAGTGAGGCGATTTGCTCTCAT
GTACATGTCCCACCTTGGCTCTCTCGTCGAAGAACTCGTCGATGTAGTCGACCTGCTCCTTAGACAATGGCCACTGCCTGGCCACACAATACTTGGTGCC
ATTTTTAAGTCAATCTCGTGCGGGATACCCTTATCGGCTACTAAGCGGTTCAGCACTTCTGTAGGAAAGACACCACGGTGCTTCCACAGAACTTCGTAAA
ACGGACTGTCCTTCGAGGCATACCAGCCTTGAGCAGCGAATTGTT