Description :
From Genome Similarity Track
Location :
scaffold_87:47503- 49060
Transcript NameFunction/comments
g3173.t1 Amino Acid/Auxin Permease (AAAP) Family

Sequence
1557 bases(100 bases per row)
TCACTTTCGGATTCTCCGTCAACGACTCAAGTCCCCGTCCCAACTGCTCAACCTTCTCGTCAAGACCTGTCCACAGTCATGAGCAAGAAATTCCTCACGC
TGGAGGACCTCAAGATGGCCTTCAACGTCTTCTGCTGTGTCTACGGCGTTGGAACTCTTGGTATGCCCGGCAACTTCTCACGCGCCGGCCCGGTCCTTGC
GGTGATCGCGATGCTCTTCATGGCCTTCGCTAACGTGTACGCGTCCGTGGCAATTTGCCGCGTGATGCTGCTGGCCCCCAAGTCCGTCAAGACGTACGGC
GACCTCGGTAAATGGGCTGCCGGCACTTGGGGTCACTGGTTCGCCGTGGTGGCTCAAATGGCTTCGTGTCTTCTAGTTCCCTGTGTGTTCCTCGTTCTGG
GCGGTTCACTACTTGACGGCCTCTTCCCGGACGCCTTCAGCCAGTCCGTCTGGATCATCTTCATGGCGCTGATGTGCCTCCCTGTTTGCCTTATCCCCAC
TCTCAAGGAAGGAGCTGGGGCTGCATTTGCAGGTTGTGCCGGCACAGTCATCGCCGATGTCATCGGCGTGTCAGTTGTACTGTACGGCATGCGTGGCCAC
CCGTCCGTGCCGTCGCCCGACCTCAAGTTCTCGCAAGTCGCTGGCGTGTTCGGCAACCTGTCGCTGGCCTACGGCGCTGGTGTGGTTATCCCTGCGCTGC
AACGCCAGCACAGTGAACCGAAGCGTATGCCGCGTGTGGTATTCTTCACTATTACGCTGATCTCGTGCCTGTTCCTGGTCCTGGCTAGTACGGCTTACTC
GGCCGTGGGCTGCCAGATCTCTGGTAACTTGCTGTTCACGATCTACCCGGACGCCGACACGGGAATGACCACGCTGGGCTTCAAGTCGGACTGGGGTGCC
GTCGTACTCGCTTACCTCTTCATGCAGCTCCACATCACTATCGCCTTCTCCGTTCTACTGAATCCCGTGTTCTACCTGTCGGAGCGTCTTGCGCTTGGCA
TGCACAAGAAACAGCAAAACGATGTGGAGAACGGTCTTACCTACGCGGACATGGTGACCCCAGCTAAGGAATCCATCGCAAACCCGTCAGTTAATGCTGC
GTCGGAGCGTCGTTCGGGTATGTCGTACATCTCGGTGGCTGACGCTGAGAACCCGCACTTCGGAGACGCTGAGGCTGAAGCTGCTGAGTACCGCGGCGCC
AACGTGATCAAGTACGTCTTGATGCGTGTAGCTATTATCATCGTGCTGGTGGTGCTGTCTATTGTGCTCAAGGACCATTTCTCGGACCTGTCGGACTTTG
TGGGCGCCTCGTGCATCTCGCTCAACAGTATCATCCTTCCGATTGTGTTCCTGCTCAAGAAATGCTGGAACTCCATTCCGATGTACGAGAAGATCCCTGC
TCTCATTGTCGTGGTGGTGTGCACGTTCTTGGGCTGTTACGTGACGTACACATCGGGCAAGACCCTCTTCGCCCCGACGGACTCGGACGTGTCGTTCCCA
TACTGTGACTCGGAGTACGAGAACACGGTGTACTACAACTATACCGCTGTGCATGGA