Description :
From Genome Similarity Track
Location :
contig_8:475025- 476556
Transcript NameFunction/comments
g1886.t1hypothetical protein

Sequence
1531 bases(100 bases per row)
CAACACACTCTAGCTCACATTAAGTTGCGCGTTTAATAGTAAGTGGCCACCTTTGGATGCTTTAGGGACCCACAGTACCAATGAGCCACCTCCGGTACCA
GGAATACCAATAGCATCGTCGCGCCAGCGGTCCAAATACAACGTTTTACCGCCCAGCGCGGTGGTATTTGAAGTCCACGTCGCAGTTCCGCCCGCGGAAA
CAGGAACTTGGGCAATCTCCTCTCCTCCAGAGTGGATATTTACTTTTACATCTTTTTTGTCGCTGCTGGAGAAGTTAATAATGACTGCACCGTTGCCCAC
CCGTTTCCAGGAGCTGGTGCTGCCGTTGAACGCATCCTCAATGGTGTTCAAGCCCAGCGTGGCAGCTTCCGTGCCGTCGTCAATCTCTCCCATGAACTGG
GTGGGGCCGCAGATAGTCTGGACGTACGCTCCGAGAAGCGTCGAAATGTCCAAGTCGTCAAACCCGCTGGTGGAGAGCACATTGAGACCAATTTGAAGCG
CTTTGTAAGTGTAGTGCTGCGCCTTCAGAGTGGTGCCATTGTTGCTCGTTCCCTTTGAGATGAGGTCGTTGATGATGACTCCGAACGTTTTCCGCAACGT
TTCACGAGACTTGTACGCTGTCACCTCGGTTGATTGTTCAATCATCAGCGGCATGCAGTTGTTGGTCACCATCGCAACGTCGTACCGAACGAGGTCCGAG
TTGCTGATCTTCAGACGAACGTCGGCGTCGCTGATATCGGGGTCCTCTTGCCTGTACTGCTCTACAGTCATCCACGTGCGATCCAGCAAGGACTTCAGAT
CAGCCCCGCACGTCGAGTTGGACTTCATACCTGTCTCGAGGGACGAGATGTCACTCGAGTTGAGTCCATCGGCGGCCTCGGTAAAGTTGGCACCTTTCAG
GAAGGCCTTGAAATGGTCCCAACTCGAAATGATCTCGTCGCCGTTGGCCAGAATCTGCGAAAGAATGTACTGCGAAGTCGCGAGAACGTATTTCGACGTG
AGCAGGTTTCCCGGGACAGTCCACCCTAAGCAGTTCGTGATGGCAATGGGTATGTCCGTCACAACATTGTTCGTCTGGTACAGGATCGCGAGTAGCTGGG
CTTGAGAAGTCTGTGGGTCAGAAGTCTTGATGTTTCGAACATATCGAACGAGTGCTCTGATCACAGTCATCATCGAGTTGGCACACTTGACAGCCCGTTT
AATGCCCTTCCCGATGTCCTCCAGTTTTCCGAAGATGCCCATAGAGGCGGCATCCAGAGCCGTCACGGCGATAACGCTGACCTTGTTGAAGATCTCCAGC
TTGCAGTCGTCATTCTGGCGGATGCATTCCATGCCGCACTCGACGGGGTAACCGATCGGGCACTGCGTCCAGCAAGTATCGGTAGCGTCGTTGCGGTTGT
AGTCCGTCGGGCACGTCAGCATGATGTGGGCTTCGCGGTAGCACGCAGCATCCGATGAAATGCTCCACGGCCCCACCCAGTTGCGGTAAGTTGAGGTGAC
TGTATTTATCGCCGTGGCAGGAGTAGCGATC