Description :
From Genome Similarity Track
Location :
Scaffold_2540:475- 2908
Sequence
2433 bases(100 bases per row)
TTCCTTTGGCAGCAGCAAACTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGGGCGTCGTACACCATCGACCTTCCAAAGTCAATG
ACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGACCCCCCTTGACCCAGCTCCTCGAAGCG
AGGGCCGGTCACAGTCGTCGACGAGGGCGTCAGAGCAGGCATTCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCA
TACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAATACGCCGAGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTG
GCAACAAAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCG
CTCCACCAGGTCCAGGCGGCCCGCAAGACGAGCGAGCTCGCCCTGATTTCCGGCCTGGGCGGCAGCATTACCCCCAGTCCCAAGGCCAAGTGCAATCTCA
AGCACGAGGACACGTTGACGGAGGCGGTCAACCTCAGGGTCCTGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAATGGCTCTCGGGAGGCGCCGAGT
ACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGCCCACTTCCATGTGGAGCGGATCCTCCAGGAGCAACGGTGTCGCGGCA
AGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAAT
CTGGGAGCAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGTCGATGAATACATACCGTACCCGCGCTCATCGTGAG
CGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGTGGGA
CAGCTGCTGATCTTCATGGAGTTCCCATAACTCCGTGGGCGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTCATCACAAGAACTCCACGTGGGA
CAGTTCTCGGGCATAACCCAGGGTATCCCCAAACAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACTAGTCGTGAAGTCCTTAAGGGGAATGCG
GTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCGACGAACAACTGTTCTTTCTGAACAAGGGCTCGTTCATAGATGCCCCTAGAAGTGTGG
CCGCCCACAAGGCCACGAGGAGCGACGAGAACCTATAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTC
CCTGGCTGACGGGTGCCGCCACCGAACCCCCACGCACACGCTGGGCAGCTTGGAAATTCTCCTGCTGCTGGTCGAGGCCATTCGAGACCTCCCGGGGCTC
AACAATAGCACCCTCCTCCTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGGGGAGCCGAAGAGACTCTGATAGGAGCGTCGAGTCTCCTTCTCCTCG
CGGAGTGGAGACTTAGAGGCGGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCGCGCGCAAGACCCTCGGCAAGCGAGAGACGTT
TGCGAGGATTCTCCTCCTCATCGCCACCGGCTTTGGGAGTGCCCTTAGCCTTAACGGCCGGACTCTCAGAGCGCACAGAGGTCCTGGGACTGTGATCACC
GTGATCACTAGCGGACGACTGCACGCTGTCTTCTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGCATCATGAGTGCTCTCG
GACTCGGCATCGTCCTCACTGCCCGAGTTGAACTCACGTTCTACGAACCGAGGGTTCGGACGATTGTCTGAAGACGAGGGCGACGGACTGCGGCGCCTGC
TTGCGCGCTTGTCCGCAGCCGCGTCACCCGAGGATCCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTAAGTGCAGAGCCTTTGCCGTGAGGCTTAGT
GCTCTTGGCCTGCGCCTTACCGGCTGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTAGCAGTGCCACGAGGCATGTTAACGGTCGAAGTGGAGACCTTG
ACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTAACTGTAAAGTGAGCCTCCGCCGCGCTCGCGCGGCCGAGTCGATGGTTTTCGACTTTGAGAATGAGA
GTTTGTGACGAACATCTCTTCATTCTGATTGGT