Description :
From Genome Similarity Track
Location :
Scaffold_2832:475- 2434
Sequence
1959 bases(100 bases per row)
TACTCTGCCTCATTCACCGTGGTAGCCGAGAGGTAAGCGTTTGCAGCAATCACTACCTTCCACTCAGGGAGGCTCCACAGCACCCATGAACAACTCCCGT
AGCCACCGTACTTCTCTGTCTTCGCTGATCCGTCAAAAGACATGACGAATCCGCTGTAATTACGGGAAAGCCTGGCGTACAGCAACGCGCGGTCCATTCG
AATAGTCGGAGAACCCTTGTTTGGAGGCGCCACCGGCGCGAGCGAGTCTTCCAGGTCAACGAAGCTCGTGATGCTTGACTGCAGTAGCTGCGCAAAGGCG
ACATAGTTCTTCTTCACGCGCTGCACCTTCAGGTGCCACTGCGATAGCAGCACTGCGAACTGAACCGCGCGTCCGAAGAGAGAGTTCGCCTTGTGCACCC
ACTCTAACGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGACGTAATATATCTTCAACAACAGAAGTAACGCCAAAACTTCCTTCTC
GGCAGGATGGTAGTTCATCTCGGCCTCCTTGAGCACACGACCGGGGAACCGTACGGGGTGTAACTTGCCTTCATGTTCTTGCATTAGCGTAGTGCTCAAC
GCCCATTCATTCGCAAAGAGCATGACGTGAACTGCTTTCGACCGATCGAAGTGCCTTAGAATGGGTGAATGTGAAATACTCGTCTTCAATTTTTCGAAGG
AACGACTTGCCACAGAAAGGCCACCTTCAACGGCAAAGTTCTCATCCTTGAGCTGGTACAGCGCCGCACCGTAGACCGCGAAGTCTTGAATGAAGCGACT
GTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTACTCGTTGGAAACGAAAGCCCGTTGATGGCCGCAAGCTTCTTAGGGTCAGCTCTGATA
CCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGCTGGCAGAAGATGCCCTTGGTGAAATTAATGCTGATCCGACACTGTGCAAATCTTGCCA
GCAATCGGTCCAGCGTCGCCAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAATATCATCCACAAACGACCGTCGACCAAACACAGGTACCAGCGATGA
TTCGTCCGGTTCCCCGTTCGTAAACACATGTCAGCGACGGGGCTGTTGACGGGTTGTAGTACAGGGTCGGTCTCTACCGGTGCTTCGCGGTCTGCCGCGA
ACTTCGTTTGAAACGAACCCTCGGCGCTTGACCCTTTACGTTCCTTGGCCTGTTCTTCGGCTAAACACATCCTCTCCGAGTATTCAAACCAACCTCCTTT
AGGTTGAACGAACCCCCAGAGTGCGTTGTCAATCATACGCTGGTAGATCATCGTCGCATTCTTTAATCCAAAGGGCATGCGCAACCACTCGAAGTGTCCG
AGTGCGCAGACAAACACCGATACTTTACGTGCTCGAAATGTCATCATGACCGCCCAGAAGCCGCTTGCTGCATCTAGCGAGCAGAACCATAGGTAGCGCT
CGAGGTCTGTTAACAGGTCGTCGACTAGCGGCATTGCATATTCCATGATCGCGGTGATAGCCTTCACCATCTTGTAATCAATGCAGAGCCGGATGTCCAG
CCCGGTTCTTTTTAATCACAATCACGATCGGCGATGCTCATGGACTATCTGAAAAGACGATCAGTCCTGCTCGCAACAAAGCGCGCAGCAGCTCATAAAA
TTTGCCAAGAAATCGTAGCGGCACGCACCGGCACGCTGTTTAATTGGGGCGTGCCCCTGTGTGTCGACATCGCATACCGCGCCGTAGGCTGGCGGCGGCA
GTGCGTTACCACTAGCAATCAGGATGTGCTCGTGGTTCTTCAGCGTCGCGACCAGACGTTCTCGGCGATCGGTCGACAGCTGAGGATCAGCAACATTGGA
CGCAGTGTAGTCTATTTTCGTGTTGATCTCTTCGGTTAAGTCCGGCAGGAATGCCAGTT