Description :
From Genome Similarity Track
Location :
contig_8:474997- 476509
Transcript NameFunction/comments
g2023.t1hypothetical protein

Sequence
1512 bases(100 bases per row)
CAACACACTCTAGCTCACATTAAGTTGCGCGTTTAATAGTAAGTGGCCACCTTTGGATGCTTTAGGGACCCACAGTACCAATGAGCCACCTCCGGTACCA
GGAATACCAATAGCATCGTCGCGCCAGCGGTCCAAATACAACGTTTTACCGCCCAGCGCGGTGGTATTTGAAGTCCACGTCGCAGTTCCGCCCGCGGAAA
CAGGAACTTGGGCAATCTCCTCTCCTCCAGAGTGGATATTTACTTTTACATCTTTTTTGTCGCTGCTGGAGAAGTTAATAATGACTGCACCGTTGCCCAC
CCGTTTCCAGGAGCTGGTGCTGCCGTTGAACGCATCCTCAATGGTGTTCAAGCCCAGCGTGGCAGCTTCCGTGCCGTCGTCAATCTCTCCCATGAACTGG
GTGGGGCCGCAGATAGTCTGGACATACGCTCCGAGAAGCGTCGAAATGTCCAAGTCGTCAAACCCGCTGGTGGAGAGCACATTGAGACCAATTTGAAGCG
CTTTGTAGGTGTAGTGCTGCGCCTTCAGAGTGGTGCCATTGTTGCTCGTTCCCTTTGAGATGAGGTCGTTGATGATGACTCCGAACGTTTTCCGTAGCGT
TTCACGAGACTTGTACGCTGTCACCTCGGTTGATTGTTCAATCATCAGCGGCATGCAGTTGTTGGTCACCATCGCAACGTCGTACCGAACGAGGTCCGAG
TTACTGATCTTCAGACGAACGTCGGCGTCGCTGATATCGGGGTCCTCTTGCCTGCACTGCTCTACAGTCATCCACGTGCGATCCAGCAAGGACTTTAGAT
CAGCCCCGCACGTCGAGTTGGACTTCATACCTGTCTCGAGGGACGAGATGTCACTCGAGTTGAGTCCATCGGCGGCCTCGGTAAAGTTGGCACCTTTCAG
GAAGGCCTTGAAATGGTCCCAACTCGAAATGATCTCGTCGCCGTTGGCCAGAATCTGCGAAAGGATGTACTGCGAAGTCGCGAGAACGTATTTCGACGTG
AGCAGGTTTCCCGGGACAGTCCACCCCAAGCAGTTCGTGATGGCAATGGGTATGTCCGTCACAACATTGTTCGTCTGGTACAGGATCGCGAGTAGCTGGG
CTTGAGAAGTCTGTGGGTCAGAAGTCTTGATGTTTCGAACATATCGAACGAGTGCTCTGATCACAGTCATCATCGAGTTGGCACACTTGACAGCCCGTTT
AATGCCCTTCCCGATGTCCTCCAGCTTTCCGAAGATGCCCATAGAGGCGGCATCCAGAGCCGTCACGGCGATAACACTGACCTTGTTGAAGATCTCCAGC
TTGCAGTCGTCATTCTGGCGGATGCATTCCATGCCGCACTCGACGGGGTAACCGATCGGGCACTGCGTCCAGCAAGTATCGGTAGCGTCGTTGCGGTTGT
AGTCCGTCGGGCACGTCAGCATGATGTGGGCTTCGCGGTAGCACGCAGCATCCGATGAAATGCTCCACGGCCCCACCCAGTTGCGGTAAGTTGAGGTGAC
TGTATTTATCGC