Description :
From Genome Similarity Track
Location :
Scaffold_2:47496- 49126
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_2-snap-gene-0.64U4/U6 small nuclear ribonucleoprotein Prp31

Sequence
1630 bases(100 bases per row)
TGTTTGTCGAACTGCTCAGGGCTTCTTCATGACGCTGACGAAGCCGCTGCTCGCTCCAAAGTACTTTTCGTTCGCCGCCTTCACGCGCGCCTTCATCACC
TCGGGGTTCATCAGCTCAATGCCCTGCACGGGTGTGAACGCAAGACTGGACGCGAGCCCCGACATCGGCGGCTTGGACGACGAGTAGCTCGCCGCCTTGA
GCTTCTTCGCCATCTGCTTCTGCTCCTTGCGCACGATGCGCAAGTTGCCCGATCCTTCCTGTCCGAGCCGTCCAGCGGTGATGCCCATCGCATTATCGCC
ATACTCTTCATCCGCATTCGCAAACGACTGGCGGTTGATCTCGCGACGCACGTCCGTCATCTGCATGCGTTCCTTCATCTTGCGGTACCGCTTGCCGCCT
CGCTTGCGTCGCGGCTTCTCGTCGGGAATCGGCAGCGCCTTCTTTGTCTTCGCCTTCTGCGGCTCCTGCCATTTCTCCATTTTGCCCACGAGCTCTTCAC
GGAATTGCGCGCCAACTTTGCCCTCGAGATCGGTTTTGTGCGGCTGACTGTCGACGCGCGCCATGAGCGCGATCTTGCCCGCGAGCGCGCGACACGCCTT
CATGCGCAGATAGTGCGGGACGTTCTGGATGATGTCCGAATAAAAGATGATACCTGTGTGTTTCAACGCCGCCGCTGACGAGAACCCACTGAGCACTTTC
TTCTGCTGACCGAGCACCTGGAGGTTGCACGACGGGATGCGCGCCAGGTTCGCGACGCCGCCAGCCAATCCAATGAGCTGCGCTGCGATGCGCGTACCCA
CTAGCTGCGACACATTCGGCGCCAGGTAGTTCATTCGACTCTCGACAAAGCCTAGGATCATCGCTTTGTCTTCGTCCAAAGCGAGCAACTCATCACACGC
GTCCACGCAGGTCCTCAGGTCCTCTGGCGAGAGCGGCTTGCCGCTCGTGCCCGAACCTGNNNNNNNNNNNNNNNNNNNNNNNNCCGATGATCGCCGCGCT
CGGCAGCAACTTGGTCAAATCCACCACAGTCATGTCCATCTCGTTGCCGATCGCCTTCACGACGCGCGCATAGTCGAGCGCGTTCGGCACGAGCGAGTCC
AGTTCGGGGAACTTCTTCGCGTAAATGTCGGCGATGAAGCGATGGATCGCCGCGATCTCGTCGTCGATCTGCACCATCAAGTCGTTCGACGTCACCACGA
GGTTGTACTCGGCCGTGCCTTCGACGAGCTGATCCGGGTTGATCGCTTCTTCCTGGTCGACGTACTTCTGGATGGTCTGCACGTGGTCCAGGTACTTCTG
CGAGCGCTTGAGACTCGCGATCGCGGCGATGCCGCGGTCTTTCACCTTTGACGCGAGCAGCCGCTCGATGTCATCGATACTAGCCTGTCCAGAAGTGAAC
GCTGCAAAGTCGCGCTTCTTGCCCACTGCGGCGCTGTTGTTGACGTTGCCGTAGGCGTCCATCGCGTCATCTTCATCACCGCCATCGTCACTGCCACCTT
CGTCATCGCCATTACTGCCTTTAGGCACGTCGTGCGCACGCTTCTCTTCGTCAAAGTCCTCTCCTTCGCTGCTGCTGCCTCCGCTGAGCTCGTCGAGATC
CTCCAGGAATGAGTCTGCGAGTGACGACAT