Description :
From Genome Similarity Track
Location :
contig_43:474912- 476673
Transcript NameFunction/comments
g7923.t1POM74321.1 RNA methyltransferase, TrmH family, group 3, variant 1 [Phytophthora palmivora var. palmivora

Sequence
1761 bases(100 bases per row)
TATGAGAGTTTAATACAGCTCTGGTTGTTCTCGGAGAGAGTGATGTCATGTTGGCTACTGTTGTTTAGCTCAATCATTACGAGTTTTAAGAAGATGGCTT
CCTGCATGCAGTGGCATAGTGCGATGTATTCTGCTTCTGTTGTGGATAACACGACTATGTAGTGTTTCCTAGATTGCTATGAGGAAATCTCATCGTAGTC
AATTCCATGTTTTTGAAGGAATCTTGGCGAGCTTTGTAGCGATCTATTGTGCCATCGCCTTTGTATTTGACGACGAATACCCACCTACATTGCAATGCAC
GTCTGTCACTGTAAACAATGTGATTATCTGTCGTATCCAAGAGCCTGTAGTCCTTCTTGTTGGATGGAATTCCCAGACACATGTATTTTCTAGCCCGTTT
TTGAGTTTGTTGCGATATAACTCCGGGGTGTGAGCGTATGTCATGCAGCCAATCACTTTAATGTAATGTGCTGATGGTTTCTTTTTTTCATGGGGAGTAA
CTTTGTTTGTGACCGAGCTCGGGGTGATGTTGAAGAGATTAGCGGCGTGTGTGATGCATTCATCCCAAAGGAGTTGGGCAAGATCTCTGCCGATCAGAAA
TGCTCGGGTTCTTCAAGAAGTGTGCGCATACGCCTCTCTGTCACGCCCTCCAGTTGTGATGTGTACGCATTAGTGAACTGTGCGTGTGTGTTATATTTTT
CGAAGATGATTCTCTCAAGGTTTTCATATTCACGAGCGTTATCACTTTGGAGGTTCCGGATTTCTTCATCGTGCATATAAGCAAGTGGTCCACATCAACG
CGAAACATGTTCTGTACTTTCTTTCTGAAATCCTCGTAGCAGACGTACAAGTCTGACTTGCGCCTGATAGTGTAGATAAACATATAGCGCGAGTAGTCAT
CAATAAAGATCAAGACATATTGACATCCTGATAGTATTGAAACAGGAAGAGGCCCAGCCATATCTGTGTCAACCTTTTCAAGAGGGAGTTTGCCCTTTAA
ACGGGATATTTATTGAATGCGTTACGATGTGCATTAGCGTATGCGCATGAGGAGCAAAAGTAGTCTGTGCTTGGATCGAATTTCGACATCCCCATGTCTG
TGACGACCTTTGCTAGTTCCTGCATAGTGCGAAAGTTAGGATAGCCCATTCGTTTGTGCCAGAGTAAAATATTATCGGACGTACCAGATTTGGCCATATG
GGCTGCATGGTCGGTGTTTACCGGGCGAGCTTCGAATTGGTAGAGGCGAGTGCCATTGCCAGTCTCGGTTTCGAACTTGGTTCCACGGTCCACATTTCTT
GGCGTCCGGGAAGTTGATCTTGTAGTCCGTTTCGACAGCTTGACGAACGGAGGGTGGGTAAAACTTGAGGTCAGATGCGTACAGCACGTTGGCTAGGGTA
ATGACTCGGTCTCTTCCCTTCTTATATTTGATGGTTAGCTTCACGTCGCCTGTTCCTGCAATGGGAATCTGGTGATTGCCCCCCCCCCCACCGTGATGGA
CTTGCCCACGGTCGGTTTTAGGGTCGCAAACCATTCCCTGTTGGACGTGAAATGGCGAGTGCAGCCAGAAACGATCATCCATGATGGATTATGGTGTGCG
ACATGTGCAGTGAGGTTCTTGGTTGCGCCGACCGTGAAAGTCGTTTTGGATTTCTTGGTTGTTCCGGCTGTGATTTCCACGGTGATCTTGGCGTTTTCCA
TTGGGAGAACTATTGTTGTTTGTTTGACCATGGTAGTTGGTCCATGAGTAGTTTGCCATTT