Description :
From Genome Similarity Track
Location :
Scaffold_30:47491- 64033
Transcript NameFunction/comments
Phyca_LT1534548717predicted protein
Phyca_LT1534528424xylulose kinase, putative
Phyca_LT1534116399Hypothetical protein
Phyca_LT1534116165RabGAP/TBC domain-containing protein
Phyca_LT1534534939Hypothetical protein

Sequence
16542 bases(100 bases per row)
gcagcctttgaaggttgagcagccagcactctgatatactcgagtaggtctcctttcaaaatccgaccttgtggccctgtgccttccacatcatgcaagt
caatactatgttccattgccaacctcctcactgaaggcgacgtcaggatcttctcttccttttcaactgtgcgaggagcaaagggaatccttgacaaaac
aggcgtcggggcaacaggagtctcctgaacaggagtagagacagccaccggctcttgactaactggagtcggtactttgcggggaatcggagctccaggt
gccttcttcttgcctccaccttgcaccgtcgcagctgtagcttcatctacgtcgatgtcaatgagcgtagaacccactttggccatttcacccacttcgt
aatgcactttagtgacgacgccgtcgtatcgactggtgatctccactgtcgccttgtcactctgcacctcgcacacattctggaactgcttgacctcgtc
tccgctcttgacgaaccactgaagaacttccacttcggcaattccttcgccaatatccgccaacttgaaggggatctcagggaacgcagtcacagctcca
gcgtggaaacgacggcgagaagcggccagatgctggcccagacgtacgcgcaatagcaaagaactcatcactggactgcgcacttggactcaaattggga
aatgagcgacggatcgacgttgcagtacatgtacttcaaatactggaccctaagtgttgtggttaggggaattgtgttttccggtgacggggaggggcga
catcacaccttgaagcggtcatctttgagctgtacatgcactagctgcccccttgttgcagcgcaaacgcttctgtatctgcaactgagctctgagtcta
agctgctcatttactcatttccccgctccgtgaagcttcttaagtaaagaaaaactaaccgtcagatgactctcccgattcaagatgacgctctcttctt
gggtttggactgctctacgcagagcatgtctgctgtggttgtagatgcccgcggccatgtggtgtacgagagctccttccgcttcgatgagcgattcccg
cagtacggaaccgacaacggtgtgctgcgactgaaggagaatgaagtggttatcccctcactcatgttcgtcgaatccctggacgccataatggacgatc
tggccaagagctctgtggatgtatccaagatcaagagcatcagtggaagtgcccaacagcacgcgtccgtatactggagcaaaggcttctctcttcgctc
ctgcttggacgttgctgagactgatgctgtttcgattgtggaggccatgaacgagcagcaagaaccggcgttttgtgtgcctaatgggcctagctggatg
gacagctccacaacgcagtactgtagggagttggaggctgctgtcggtgggcctgatcgtgtcgctgaaatcagcggctctcgagcgtacgaacgcttta
cggggaaccaaatcgccaagcgaatccatgaggatcctgcattcctggagaaatgcggacgtattgcacttgtctcgtcaacgttgacatcactgctgtg
tggtgactacgctcctattgacgacagtgacggatcaggcatgaaccttcttgacgtccgagaacgagtgtggtctcctgagctcgtcaaagctactgtc
aagtacagcacttcaactaatgccccagagaagttgatcgcagccttaggctcgcaggtttcacgagcgtattcgtcgatgggtgttatccacacctact
tccaaaagaagtacggattcgctgttgattgtaaggtgatcgcgttctccggtgacaatccgtgcactctagcaggcatcggcctctctcagccaggtga
tgttggagtttctctgggtacgtccagcacgctgtttgcagtggtgcctacggaagtagcgcgcttctcaggtaaggaagggcatttcttctgcaatccc
atcgacccaaagactgttatggctatgatctgcttcaaaacggagcactcacacgtcaagaagttcgagatcgtcgggcgggtgcgtcgtgggagaagtt
cgaggaactcatgcaaactaccaaggcaggcaatggaggcacagcggcgttctactaccaagatccggagatcactccgtccacgttgaaagctggtgtt
gtcggcttcgacgccagtggtgcacgaactgacgtctctcttgcagctcctgaagtggaagtgcgagcagtagtggaaagccaattcctgtcgctgcgtc
tgcatgcagagagacttggtgttaacaaacctcagcgcctgatcgttgttggtggtgcatcggcgaacaagtgcatgctgcaagtgcttgccaatgtctt
caacgcgccagtgtaccgtttgacttgcgcctccaattcagcagcactaggtggtgccttccgtgctcgtcacggattcgcttgtgctggaagtgaatca
ggatacgtgccgttcgatgtaaacgacagtctcgacttcaccctgagcgccaaccccattgacaatgacgccaagacgtacacgaacgaactaccacgct
tcgagtctctggaaacccaggcagtcaatctactcagctaaaccaagtccctgtcctgttgctctagccaaaggtaaaagaacactttaacttgaatcca
agcaactctttgatcgtctacaccaagaggaggtcatccctcccgtctattgttactgcatcaaaacattctctgttgatgcagtaaattgcatcaaaac
atttgtattgatgcagacgaaaggtcattggggacccgggtggtgaacccgggggggttcgcagttcgaagcaattaaacgtgtatcaaatataaagtta
gaaagaactattttaaagaaatttcttttaaaaagttattaactatggttcattttcaactgaaggtgttttattcccttagctatctaaccattagctt
gctgtaaacttgttagtgtattcgcagaaagccgcaaaagtcgattttcctctcgtaaagcggagtggggaggctgagaccactgtgctaaactagcggt
aaatggttccaatgtagcaaacgcgaatcgggaaacaacacgagataccaaaagatacgtttgttggggtttattcacaactccaacaggcgacttccat
tccacgactaccatggagtgaagcgtttccccttgtactttgtatatggttgacccaacagctggtacaaacggaaattgttgcaatttcacgggaacag
atcttgtgtctccgttaagagttcgtggaagcgggatagatgttttggagaacgactgagtgtcataaaaaactggaaacaggtcagcttctgctgtagg
atcgaaaggagttgccccagggcctcgatcaagtcgaagcaaggcgaagacaggcggtcgacttggaatgcgaaccgtcattccagcagagctgtctcga
accagcctgaaacgagtatccgcagaaaacgtcacgcgttctaaaataccaagcgtgccatttgcaaccccctttgtgggccggacattttgcgtcactt
ggataggcatgccttcaataagatcgagaaacggagccatacgtccaaagcgcgtgtcaggcagccccattatgtattccacatcgctacggctcagacc
gcctagactgttcttaaaatttgcaactagccgtaatggataatgccccgcaggtagtttttttgcagcctctttcacaaactcattattgatagccgct
cgagtagtattgtcgggtgtaacaaagacagtatctgcgctccattccgtgctgtcaagccttttaacaagccgagaattgattaaattaatgaaatcct
tagaccaatgtcctaggcgcgcagctgcacaaccctttccccactctgggtcatcccgaaagcgaaccgactcctcgagcacaattactgtttcaaaccg
acgccacagcaggaaaccctcgatgtcagctgttgagtatttagtcttggtgcgaggatcaatatatattggatccgatccgactgggggtagctgcaga
aaatcgcctacgagcacgatatgaagccctccgaatggaactccagatactcgtttatatttacggagcaagttatccagctttagccagtcttttttag
tcagcatagatacttcgtcgataacgagcatttcaacgccgacgaaactgtctagattcgaccgctccaaagagagaataaagcttgcaagggtcctacc
ttgaattagcgtggcagctttcccagttaatgctgtttttaacacacaagtagctcttctccaactactgcagaattttgtcacgcgtctattaccctgc
tctttcctgtaccaccggctccgcccagaaagaacagaagttgatcacgagacagcgcctcttcaaaattatccccttggtaacaacgttcacttgggtc
agcccgtaaccactttattaataaagcgcttccaattttgcaaaacgcagcatgctgaagtgggttaagcgtaaacgaactcgaaacagcagaaagggta
ggaaaatcattaatatttgcggaagcttcggcggaagccgaccaaagcatattctcggggcgcaaagcgtctcgtataagctcaataacggctgttggat
gaatcaacgggtagtcttgaggcgcatcaggtattaatctgttgtcggtgttatcatcttttacccatttgcgcaaaaccctggcttgggggacagaata
gccactgtgagatgtgccgtcgcaacgccccacctcttgtaagcgcgcataatccgaggccgtccgtgaagtaatccccaaaaacatttttgtgttcgtt
atcgtgaacagaagatctttagaatgcgatggtgtttcttgtattgatgggtaccgaacaggggtcaactctgtagtttcgcacagcgcagtcgtcgcta
catcccagtcaccagcataaaacgcactgccgttgtcgccatagtcaccgccgtcagtaccaacgtctgaaaacgggtccaccagagcagaatcatcgag
gtcactgtttctctgccagaataatattcatccatttgcgatctgatatggcattttctctgccagaataataatcatccatattggacattatagttct
gtcgaaggcactgggcgaatccaaccaacgagatctcgaagttggcggaagggtttgaaaagtaccaatgcaattttcgaacggagcgctttagtttcat
tggatgaagataagtcaacgtatggcattctaggaccaattatgacgggtacgaaatctcttaaatgctcaccgaggcaatgcgatccaaaaagaggatg
ttgatcaaggaatagtatatcctttgacgccgatttagttttttttcgtctgaaaaacttcatgcaaaacttgtagagattgatgctatcgtgcttaaga
ggccgaaacatataatcatccagagatgcaactggtttgtacgtaatgcgattggacccatcgtgtggtggattctccgagcgtttagtctccaccagat
cacaggaatagtcgatgtcaccaaggagttgagcgaaaatgttataaagcaaaagcttctcgcagcgtgcgctagagtacgcacacgaaccgcgctgaac
atacagcgctgcgagtggtccggatatctcctgtcggttagttacgttgtaggccattgccgcgacacgctttctacatttttggatgttgcctctcttt
ccatcgcaggtgcccgcatcgactttctctttttcctctcgtcgccggaatgccgcaagagctaccgcagcaatcgaatcgacttgattttgagttttcg
taacgtatttgcaacagtagtagattcgagcagccatatcctttccgcctattaagagttggatatcgtgatttgacttaaaagtagccatcatcaccgg
attgtacccgttgatgtactcgtgccctggcattcggttcaattcaattccatcctttcgaaactctgttgatggcacaggttctcgaggaaacgagtat
cgacaggtattaggactagaagaaaaacgagaatttttaaaacagctgccagtatgagcccaccagtgctcgttaagcaaacgacaagcgtcgacaccat
gaacgcgaaatcgtgttgactcatccggctgtcgtcccacataggagggagcatctcaatcaaacgaacgatcttgtcgtcacggaggtcgttacgttca
agtagacttggcggtagatacgatacaatcgtactgtcccccatcccatcgcataagcgacgcaaatactctctatgcaaaagtttgttactagcctcag
cgacagtgcactgacagtgaccttcagtttctgcacgtcgtaaaacttgctcgggtaataattcattaactttggggggccacgaagaaggcctgtgatt
ttgtaaaagagcgcgcagagccatctgagagcttaatttagagccacaaacaccacagtatagcaacagaggcgcctgcgattgactgtttttctttgga
tccatgtaagccgtaggaggtatcgagagaggcttcaagtcatcggccggggccccacattccggacagcgaaccaaagaagaaaggggtagcgagttgc
caacaacactagcaccatacgctaccaccgagttcataaatgaagctctcgtttcttcgcttgtgattagctgttcaaattcagtgctgtttttaggaat
attgagaagccaaataataaaatgagcatgcagagttcctccgccctgcgtctcgaccataccataatatgctttcacaggaccaaataacccaggatac
gacttcggttttcctgtttttttatcgagggcaagaacatcctcgataaaggcatcgatgcatctcgagaatagacgagcagaagcgacgtcgttaccca
ttgtagccttgcgcagctctgcctttgaaggaagcactgactctagacagtcaaataggctatccacactagtaataccagtatattgagccatcgtaaa
cgaattcccaacgtttggtgtaatagtcacgaataatccaggttgtccaaacagtgcctgatatgcaaacgcttcccttcgacagcgttggcgctctaaa
ctacctccccacaaggatccagtacccttttgcacagatctgaggaatcttccggctggggagagatccactgtagtagaacctatcctcccttgctgcc
gcaactcattttcgcgaagtgctgcggatagttgctcacaagtgatagaatcataaccgcgaaacaaatttgggtatcgtttgcaagtcagagagatttg
cataaacattcgctttgtcgccaatcgatcgaacgcgaccagcataaacgtttcatcttccgcaaatcgccgcgaactgagcataccatagtaattaatg
cacgcattcaacgagacgggaacggttcgcttttcccctggatgtccatgcccgtatggaaatagatgagggaacatttttgcaaaaatgctaccatcat
cgtcattagaaaacgtcgacgagtttcgcactagaaagcgccgattagaattcaacccttgctcctcagccgggatctccgtcactaaagaagggttaca
ggaatccgtacttgttgtgttaacaaacactaagctccgctcgactagttcgcactcatcttctggtgtactagctacatccgaatcgttctctgctcca
acacgcgcttgatctttgtcgacacctgccacgaggtttgctgctgcgttttcgtcaaaatcaataagtgcgtcatctattaggcaaccacaagcgttgc
tgatgcggtcgtggtcaatctcaacccgcgcgtaaaagtgattgtatctcttgtagaagcgaagaagctcttccaccttgttaccgcgaactacgtgaac
gcgtcgtattttggttaattgtgcttgtgtaatctgccctgcaaccacaactctgtacgtagaaagcttatccaatgtccgcggaagcaacgtagcaggt
ggtcccggtgtggcatcaaaagccatacagtgtgatcgaattgaacgatgagcaccaccacgcataacccgcgtcaaagctaccactgtcaccagttgag
tcatcatgcgttcagtaagggttgtgtcaatcaaagtagcgtccaattcaccgatacaaaaaccgtttttaatagagaatttcggaagctcccgttgctt
aatatggccactgcactcacaacacatacgtagacgagcaacgctctcttgggttgctgctaacactccttttttcgacaataccataccacggaaagct
ggatcgatacttccacagtcataatactgtatcaaatcgagcggtagatccaatccagcggaactcaatagcgtacgcatgacatccatactagacttgt
cgcagacggtaaactctaggctggtatgtcttactacccagcgatcgcaaacagcgcatacgcactcatctaaagtttcagctccaagcgaaattcggag
ccgttgaagcacatcccgctgaatagcatctgataccggctccaacaatagttttggaggcggtaatttccctccctttcggcgtttgtaagcgcgggct
ttttgaagatgatcttgccgctgatcctctgacaatcgttcgcgataacgctttacagcagctttatttttgcttcgagtcgtcattgaagaatcgcttt
aaagctcaggtactacgtttatttatcttgcgttttatagggtcactccgttttaacgcccgagtcaagtccaaatccaataaggctgctgcttccttta
gttttccgtctacttgttggacgatagtaataacagctgctgcgtcttcgattaccgatcgtttcagcgtcttctccaacacagctgctacacggcggga
tttagaaatcgcttgctccaaatctaatcgagctttgtcccccttttccggatcaaagagtaaaatgtttgaaaaatcgctttttgtcgaacacaacgct
cacagctcagctctccaaatccacagatagaatcgcacctcgcgcactttgcaccactgcgcctacgctttctctcccccatacaacctcgacacaaagt
cacaggaattacgcgctatactaaagacagtcgcggaggccctctgatcactcaaccgccaactgattctatctcgaaaacgaggctgttggacttatgc
gagggtttcaaagtggcgggtcggcttctagcagtagcaagctaaggtagaaaagtttcgggtagtggtgtccacagtcaatccagcaagtcaaacaaac
gatcgtggcgtctactagtcgaaagctcccagataataacgcgatgagaggcgaagcggttcaagtgcgcgtatctcctggtatttgtgactacgcggta
gttcagagtcgtaaccccgtggtactgaaaagggttagaagccgtgtgaaagttcaaaaatgctaaatacatgccttggcgaacgctaaccggatctagg
ctcgaaaatctcaagcaaattcccgtcgacgatagagaacaaatcaatcaacacacgcacgattataacgagaaaaatgcgtatgggttgtgaacctacg
tcgtaacatttctgttaaaattccttcactcgccctgattgaccgattgacaggaacacactgctagaattggtactgtacaaaaccgtttcagtttcta
gccttttctaatttaaaaagactgcattggtgtcaaggatccgagaaatggcagcagttttggagaaaaacgttttccctaatcaagatgtgtgagcgta
tcttcaactggtggagagatgtagatcgcactatcaggtaataagcgggtaattttctcagtggaatgtttcttttctgtccttagtaaatatctgtcat
ttctgacggtcagcctccaagatatatctagtgttttcattttccattttctcgcgcacaagcaactaccatggcagcctcccaaacaaaaaagcgcaac
ccgcctgtcaagcctgaaaatactcttgcggagcaaaagcggcagcgccgcgccgtgcagaaatccattcctactgcacaagcaaacactggagagaatt
cgaaaagtaacgctacgccttcatctaacgtcgaagagtcgtcgccgcgtgaaaaccttgacaagaaatcaaacaaagtatccgtcgagaacaaatctgc
ttccgatattacaagcgcagaagagaagagcaacaataagagcgaagcgagcgaggaaaaagcgaagaaaacatttacgggaatgtttcgagtaacattg
tggatgttgctgacgctgctgctactcccgcaccgaagtatgtatcgccgctgcaacgcctcgaagcgctccgagcggaacaagcggccggattgcaaac
aatttctaccgtggaaaaactgcagcagtttatcaagtctaacaatgtcaatgaacctgctgtccgagcgcgacttcagatcaaggggaaagtggtgtgg
acgtcattccatatagtaaaaacaggcgagcttgcgcggattcatattgtggacctggaagcaatggaacctttaagtgcgatgcaaaaggcattccgtg
atgactacgggcgcgactacctttcagttgaccagctgctcataacagtaactgtatttggcgcatccgcaacttccccaggattacctcccgacggtgc
aatcgtgacaatcaccaacccgtcgaagcttcagctgttcatggacaaggcatgccagttgaccaccaagctggccaatatgacgtttgagaatagctcg
agtagctaacagacctaccattggagaccactaagattctacgctgaaaggaaaacgtctccatgggggaacgccccattttcataaataaaagcttcag
ttgcgcctctgttgctatactgtggtgtttgtggctctaaattaagctctcagatggctctgcgcgctcttttacaaaatcacaggccttcttcgtggcc
ccccaaagttaatgaattattacccgagcaagttttacgacgtgcagaaactgaagctcactgtcagtgcactggaccgaggtggtccatttcaggcgac
gaagacatgcccaaattcatttttttatgacgataacgaagcaaagaacgttgatgacactgatagcgccactgggagaaacatcttttccattcgaccg
tcgttcagattgtcggacggcattgacttggagaacaggattgtgggtgcggtgctaatagtcgcgtgaatgttgttcgatgtcatccaacgctatcaaa
tgtcgcgcaaatgttgttcgatgtcatccaacgggtgaggcctatcaaatgtcgcgcaaatgttgttcgatgtcatccaaaaacaacccctaaacgacag
ttcttcgaactgcgttcgatgtcatccaaaaacaacccctaaacgacagttcttcgaactgcgaatagactgggcctcatagctcacctcctggttgagg
ttcaaggtgccagtcctcgaatagctcagtagagtgcactacttccgttctaatgtccttgttgtctacgtcccgcaactccttcactcgccgtctacgg
cgtacaccgcttcttcgagcgttgcacgtggctcctccactcgcacaggcccaagaagaagaagatgacgcattgccagtgctcgaaacgcagcagatga
acatgttcacagctatcaatgacgccatgcgcgtggccatggagacagaccccagtgctgtgcttttcggtgaggacgtggccttcggtggcgtctttcg
ctgctccgtggacctgcgcgagaagttcggcagcgaccgcgtcttcaactcaccactgtgtgaacaagccattgcgggctttgccattggttacgcgtcc
acaggccgcacggcaattgccgagattcaattcgcagactatatcttccctgctttcgaccagatcgtgaacgaagcggccaagtttcgttaccgatcag
gcaacgagttcgattgcggtaaattgacgttccgagctccgtacggagctgtggggcacggcggacactaccattcgcagtctccggaggcgtacttcgc
acacacgcccggtcttaaagtggttgtaccacgcaacccggtggcagcaaagggtttgcttttggcatctattcgggatccaaacccggtcctcttctta
gaacccaaggcactgtaccgcgcttcagtaggagaggtgaggcagtcaaattgagtgaaggaagactggatgaagtgctaacaagtggttatgtgctaat
gcgctctaggtgccagtgggggagtacgagaagaatctgagtgaagctgagatcgtaaagcgaggtaacgatgtcacggtggttgggtggggcgcacaga
tgcgggtgctcgaggaagcctgcggatacgctgaggacgtcgggatcagctgtgaactcattgacttacaaacgatcttcccttgggacgctgacacaat
tgaacactcagttcgcaaaactggtcggctagtagttagccacgaagctccggtgcgtaactgttcctgatctcgaagcgtgtacatgtactgatatttg
ctgtttggtgtagaaatccggtggttttgccgctgaaatttcgtctagtatccaggagcggtgctttttgagcttggaggcccctatccagcgtgtctgc
ggctacgacacacccttcccattagcctacgaatcggtgagtgctctgaactgtagctgctcttgttttcactagctaatttgtttttgatgttgggata
tttcagcattaccttccggacgcgctgcggaactttgaggcgatcaaaaaagtagtggattactagccacattatacactcaacattttgatattgatac
ttggctttgccttcttacctttgagctttctgtgcttcgggctgtaagaggctttcgtaatactgacaaaacaactgcgtctgcgtaaattcgtcgaggt
agtcctcgtacatgctgttccgtacttccttagcgacctcttcctgcaggcgatcgtagaagctctggccacctaataacacgcacacagttagtcaacg
tattctggaatatacttcatgttcacgtagtagtaacactactgatgacttacccgatatcgatgctgccagatcttgagatgaaatgtcaaagcccaga
tcacgcaggaaaatctcggcttcttgcatcgtcagagtgatgatcgtgtcttgctcctcggataattcgtaccatggcttgctggtgggacgtaatgagc
agaagcgctctcgagctttccgtagcaagcgacaaagctcaacaccattggggatcgacgatggacccaggtgcctcgtcacagcaggtaccgcaatgcg
atctctgtcgatgtcgtaaaagcaaacatcggaccactctgctgtttcactcagcgagtgacaaccaacgaggaatggcacgggggagtgcaagaagtcg
agtagccctgaaggcagtagggggatatatgtcgactgccactgaaatggcgctaacagaagtaaaagcgcagtacacactgccgatatcttggcagggc
tgtcgctcatgattacaacctgcttctcaagcagcaagtacgccataatctcgaccactttgtctggtgtcaaaaagcgtagcacaacaccaactgacca
tcgatcggagtgtcgtttcgggaactggtagctgaagtcgaacgccgggaatcgagtggaagaccaatgccctgggtcgttaatcttgattcgccgtgct
cggtgtaatatctacatgtacaaacaacacatcaaatttaatgatcgagttctcctgaaaagataatagcgacgtacatcaaccgaagaagcagataagt
accgtcggtacttcgaccgcttcgttgcagtcggagagctctgtgaggtaggtctgcggaagcgaagacgcattggccgattccctttttcaagcaatgt
cagagtttgctcaaaactcatagacgctgatagataaatgcacaacgtgaatatggtacgttcggaccaaaatggtacggatcacttacctgttgcaatg
ctgtcaacggcctcgaggatatctccgacttttacgcgctcatactccttgggctggcttgcgtcaatactttttaccatgggcttatccataatccaac
tgctcgctgcgttgtagttgctgatatcgtcggtgctaaggcttttccggagttggctcggcctctttcttggctcagcacttatcgctgcatcttcttc
aactttggccgaacctacactcgcatcttcgctcagaacaacacgccgattcacagcggatatgtccagcttagttgcaatagaagccattttgttctgt
tcgtcgaaggctgcggtttgatctcgcatgcgtgggttttcctcgtggtagattgtaaactccaccgcaagatctagcagtggtctcaatatgacttcaa
actgctcatcttccttgacttcattacctggctcatccacagaagtagttgacaacaatctgtgctgctccatctcgttttcaatgatcatccgtaacag
ctacacgacaacaagttagtagagctcaaaacacttttcaaagaaaccaattcccaatcccgtaccgtaaagtggaaacgataaaagggaaacttgctcg
tgaaacagtagcacatcggtgccatcttactcgtcatgttgatacgacttcctttgctcgagggtgacgaagaaccgccaccaaaccaacttgacgacca
gctagctctcggactcttcggtgttgagccacttcctgtcaggatatcggaagctgtaacttccctcataactgcaacgcaaaatccgtacaagacctcg
ccttttgcgccggtaagacggaacgtatagccacttgtctctggggattctttaatgtgtttttggagcggttcgatatcggtgaaccattttgccactg
gcacgccaagaatcgcttcagcttgcttgggcgtacacatcgtcaaaggcacaccccttggaaagcagaagtcggcaacagactcatcaggtggatcatt
cattcgctagtaaaaacaccacacaagtcgatcacttagctgctaccaaagttatgaaaggtaaaaactgacgtacgttaggataatcgtagagcagctt
cggtttccagaacccagcaaggcctgaaggttgttgctgtcggtctttttcactgagcgacatccctgttacgaagaagcgctcgaaaatgtgttccttc
ttgaggtgcattgaaaacatgatagaacgcgccacgttctgcaacttgttcgggtgtgcgcgagcataccacagatcgcgtgaagacggtttggcgtgca
taatgcggtacatgaggtgttgctgctgcgataattcgctgtcagcgccattcttaccgtcaattattcgctttgacgatccaccaaacgcctccaacgc
agatccagtggtcgatgatcgactcatgcgtccaggaatccctgtggttgtatttaagtggtgcatgatagactgtcggtctcttagctccagtgctagt
gacgggttaaacggctcatgtccgtcatttgttctcatgggccgacgcagcttttccgtcaggatttccgactcgtgtctcgttgcatccacgagttcag
ctggagttcctggagcctgatcctcactgtcgtcgctgtcttcttcactggaatcgtcatcaaagtcgaatgacgacagcgtcggactcagtaaattccc
tgtgtggtccggactacacagtacaattcattaaagtggttaacaacaaatgaccatcactctgcaacgtacttgaaggaggaagctttctcaactgaag
caacagtggaagcgcttattccgtttggatgatgctccgtgcgtacgacaagatccagtaagtctctcgctgtcttctgacgtcgccgtttctctaccaa
atatttctccttccacttttgcgcttcatactgagccaatgccagctcgttctgcctcgaaattgagtagataatcagataacaagcataaagaaacgtc
attgtagtggcagcatacctggagctgctccatcttctcctgccaggcgtcgcccatggcgctctcctcgctgaagcgagaagtcattgcggagtcccca
cacttgggttttgtattgctgccaatcttgtagcatttcattttagagcagttcagctggacgagcaggaaacgatatgctctacaagtgtatgaacttc
aacttcaacaatcactgaaataaaacgtgtttggatgtaccagttaccctgttacaacaaaataaaaagcgaagcagtactgctcttcttcaataatcga
actcatcacactacataatggcacagctgccctggcttccct