Description :
From Genome Similarity Track
Location :
Scaffold_47:47484- 48485
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_09216Hypothetical protein
Sappa_CBS223.65SPRG_09217Hypothetical protein

Sequence
1001 bases(100 bases per row)
CGCTGCTGCCCACGGCCGACGCGCCGCCGCACAAGAACGCAGCGCAATTTCTCTTGATCAACCTCGTGCTGCCGCTCCTTCTCTACTACGTAAGCATTCC
GTTCGCGACGGAGCTGCACGCGATCTTGCTCTCAGCGCTGCCACCCGCGCTGGAAACGCTGTACCACATCGTCGCCTTCCGCTGCCTCGACCCGATCTCC
GCCCTGGTACGTGGCAGCGGCATATCAACTCTGCTATCTTGTTCAAGTAGCAGGTGCTGGCGACGGTGCTGGCGCTCGCTGTCCTCTTCGTCACCAACGA
GCCCAAGGTGCTCCTCGTGAAGGACTCGTTCACGACCATGACGATCGGCGTCGGCTTTCTTCTCTCGCTCCAGTCGGAGAGCGAGAACCTCGTGTGGCAC
TACGTGCGCGGCTTCTACGGCTCCACAGACGCCAAGCGCGCGTCGCTTGCTACCTACTGGCGCCATCCCGAGGTCCAGGCGGTCTCGGCGCGCGTCTGCC
GCGTCTGGGGCGTCGCACTCCTCCTCGAAGCGTCGTTGCGCGTGACGTGCATTGGCCTCTTCTCGATAAGCAGCATCGTGCTGCTGTCGCCGCTGCTGGC
CCTCGTCTTTGCTCTGCTCGTGCTGCTCTGGACACGATCGTACGTCGACCAGTGCAACTTGCCGGCGCTTGACCCGCCCACAGTGTCCATCTACCAAGCG
ATCTGATGCGACATGTGGTTTTATATATATCATCTTTCAACCGAATAAATACAGAACGGGGGACGAATTAGTTTGCTCGACACGCGGCGGCGTCCTGCCA
GTCGGCACGGTAGGCCACCGGCAAGTCGTCGGCGTCCCAGCACCCGATGGGCTCGAGCACGCAGAGCGCATCGACCTCCTCTGCGCTCGCCAAGTCGGTG
TCGTAGGCAGTCGCGCAGACATAGACGGTGGGAGGGCCGACGTGGTCTCGTGCCGCCGTCGGAGGAGCGTCTGGTCGCGCCGAGCAGCGTCCATGGCTGT
A