Description :
From Genome Similarity Track
Location :
Scaffold_154:47483- 49201
Sequence
1718 bases(100 bases per row)
AACACGTTTTTTATCTTTGCCTTAATATTCGTGCGATCTAATAAACTTCAAAAGTTAATGTGTATTTGCTATTTCACTAAACAAGGGAGACCTGTAATTC
ATCCATACTATAAAGTATAATACACTTCGCGCCAAGATAAATCACCTCTCCGTTTTTTGCCCTAACTTTCTCAATTTTTTGGAATTTGGAGCTGCCGTAT
AGATATGTAATGTAAAAGTATCATATACATATCTATTTAAGCGATCACGATCAATTTCGCATTTTTAGCGGTACCTCAGATACAAATTTCTGATTTTACC
CTGCGACAAATCAAATCACCTTTTTTCAATACAATAATCAAGTATAGAATCAAACAAAATATTGTGGGTAACTTAGAAATGTGTCTTATTTCTTTTCCTT
TCGATCACCCCGACGCACTGACGGGGCATTGAATCCACCAGCGACGTAAAATTTCATTCGGAGTTGTTTCTCAATCATCCTTCAAGATACAGTTAATACT
TGCACACTATCAAGCTGTCTTCCATTTGCATAAACTTTCCTACTAATGATACACCACAAGTTCCCTATAGGATTTGGATCTGGAGAGTTCGACGTCCAAT
CCGGCAATTTAATATGTTCCTCATTGAAAAACTCAATGCTACGTTTTGATACATGTATACTCGCATTGTCCTGCTGATAGGTAAAATCACTGCCATGATT
CAAGTGTTCAAAATGGAGTAGATTCTCAGAGACTGTGCGAATATAGTCTTCCGAATTTTGTCTTCCCACCAAGACGACGAGATTTGAGTTACCAAGGGCA
CTGAAAGCACCCTATACCGTGACTTATCCTCCGCCTGCTTGTCTTCGCTTAGTCTGACGTGATGGAAGGCGGGTCGCGCCAATAGTGCTGAAGTCCATCA
GGACCATCTAGGTTGCACTTCTTATCAGAGAAAATAATAGATTCCCATACAGTACCGGCATCTTTACGCAGTAGCGTGCTTTTCGTCCATGCCACGCGGT
CAAGCATATTCTCGGCTGTCAGAGGAAGATTATGAACCATTTTGGCATACTCCAGCCAGTCCACTCAGGCAAAAGTACGTTGGAGCGTCCTTACCGAGGC
AGATATGTTGAGTTTGTGCGTCAACATGGCGGCAGAGGACTCACCACCAGCAGTAGCGCACACAATGCGTAGGATGTCGCGGTCAGGAAATTTTGGTATT
GGACTGGGAAGCTTACATGTCGTAGGAGGAGGTGGATGTATCACTCTCCTGATGATCTGAGCACACCGTCCTGTCAGGTGCGCGATTTCGGTCGTGCCTA
CACCAACAATATAAAAGGCCATAATCATTCTTTTCTACCTCTCCGTTACGCGTGGCATCTCCCTCGAGGGTTTGTTCTTCTTCTTCGCCATCTACTTCAG
AAATGATTTTATAACCCCTTCTTTTTTGAAGCTGCAAAGCAACTCCTTAGTACTACTGCTCATCTCGTCGGGCTTTTTTATACTTCATTATTGTATTAAG
AAAGGTGATTTGATTTGTCGCAGGGTAAATCAGTAATTTGTATGTGAGGTACCGCTAAAAATGCGAAATTGATCGTGATCGCTTAACTACATATGTATAT
GATACTTTTACATTACATATCTATACGGCAGCTCCAAATTCCAAAAAATTGAGAAAGTTAGGGCAAAAAAACCGAGAGGTGATTTATCTTGGCGCGGAGT
GTAAGTACGACCTCCGAC