Description :
From Genome Similarity Track
Location :
contig_126:47481- 51323
Transcript NameFunction/comments
g13544.t1POM72418.1 Hypothetical protein PHPALM_10866, partial [Phytophthora palmivora var. palmivora
g13545.t1hypothetical protein
g13546.t1OWZ18425.1 Membrane protein [Phytophthora megakarya

Sequence
3842 bases(100 bases per row)
TAGGCTTGAGTGTTTTGGACGTCCCGGTCGACTGAGCAGTCTTCGAACTCCGCTTGATGACCTTCTGTAGTTCAGCAGCACACGTCGTTTGAGCTTCTAA
CCCACCGGCAAACCAATACAATAGCGCTTCCTACCTTCTTTAAGGTAGTGCGAGGTCGGCGCGGTACGTGAGCGTCGTCGTGTTTAAACTCCTCTTCGGT
TGCGAAGCTAGAAACGTAGCAGGAAGATGCGACGGATGATTTCGACGATGCCTTAGAACTGCCTGGGAACAGAGCTCGCTGTTCCTCTTCAATTTGTGCC
TTCCGGTGCAGTCGCTCTTCAAGCTCTCGAATCCTATCTTGGTAGAACAGCTCGTTATTCCATCCTGCTGCTCTCTGGTAACAGGGCAATCACCAAGTCA
GTGCTCGCTTTCGCAGAATGTATCGAAGGTCACAGTACTCTTCCTGCCTTCGTGGATTTGAACCAAAGCTACTGTGGGGATCTTTGTCGAGAGTTCGTTC
ATCAAAAGGACTCGTCAGTCTCTCAAGCAACTCTGGTTGCCGTATTTCCGAAGTTTGCTGTGAAACCACTTGGCCCAATACCCCCGAGATGGCTCGGCTT
CGTTGCACCTTTGTCTATTTAGTTCAAGAAGATCGCAAAGGTTAGGAGAGAACGCGGTGACCAGTCCGCAGCACTTACGCACGCACCTCCAGGGATAAGA
CGGTGTGCTCCAATATCCGTAGCCGATTCTCTAGAGTGGCGGAAAACGCCATTGCACGGGCAAAATGAGATTCGGACTCTTTCCTTGCTGCCTGGAGCTG
CAAGCGACGACGGAGAAGGAAATCAGTCCACTTCATCTAAAACGTACGACCCGCTTTACTTCCTACCGTGCGTTCTGTTGTCATGCCTGCACCTTGCTGG
ATATTTTCTCCGACGTCTTCCAGAGCGGCAAGCATTCGCCTCCTCTGACAATTAGCCGAGCAGCAACCAGTTAGCCGCCATGGAACAGCTCCAGCTTATA
CACAACAAACCAAATCATCTGTGCGAGCTTCGAACGAGTCTTCGGCAGCAGCCATTCTGTCATCTAGCTTGGTGCAGCGGTCTTCACTCGCTTGCTGGGA
TTCCAGAGCACACGCTTGGAGGAGTTGCAGTGCATTTTTCAGTGCATCTTGTCTCTCTCGTAGGTCCTCGACTACAGTCGCCAACGTCTCACTGTCCTCT
TCAGCTATAGCAGTTCGTCCCCTCTTGACATCATCAACCTCGGATTGGAGCGCCACCACAGTTCCACTGAGAAGATGCTGGGTGTCCAGACACTTCTTCA
GCACCCCCTTCACTTCTGTATTCCCGTGCTCAAGGCCCTGCTGCATCTGGTTGAGACGTTGTTGCATCTCACCAACATGCGCCTCGTATCGACCTGTTCT
CTCCGACGTCTCTGCTCGCCAGGAAGCGTCAACCTGGTGCACTAACTGCTCCAAATCGTTGCCCTGAGGTAGCACACGCATAAACCGTCAAAGAGTTCTT
CGTGAATCACTACAAGCCAAGTATTAGCGAGTCTTACAAGTTGCGCCACCGTTCTTTCTAGCTGGAAGCTCTTCTCCGAAACAGACGAGCGTACGAGTGC
CAATTCCTGCATCGTCAGGAGCCCAACATCGTTAGCTATCCACTCCACCATCAAATATGCCGATATTCACCCACCTTGTTCAGCTTGTGCGTTGCTGTGT
CGGCCAGGTTTGCCACCTTACAGTCCGTCGCGGACTGACACGACTGAATCTCCTCAATTCGGGTCTCAAGAGCGAACACTTGCGCCTTAAGCTCCTCGAT
CTCGTGCTCTGCTTGATGTTTGACGTCGTGGAGTGCGGCATCGTTCGTCTCTGCGAGGCGTGGCAAATACTCCTGGCACTGTCGAAATTGATCCTCCAAC
GTGGTCATGCGGGGCTGCTGGCGCTCCAGCTCGGCTGAAAACTTGTCCATCCAGGCGTCCACTTTGGCAGTGTGTCCTGCGAGTTCGTTCTGCGTCTGCT
GCGTCGTCTGCTCCACGTACTCCTGGTTGAGTCGGAAGACCTTGGAGAGAGACCCCACCTTCTGGTCGTTGGCTAGCTGCGTGCTCTCCAGCTCAGATAG
ACGTCTCTCGAACGTCTGCGTCGTCAAGCACGCAGCCGAGACTCGCTCCAGCTGCACCTCGAGGAACGAGATGTAGGCGTTTCGATCCGTCAGCAGCTTC
TTCGTGTTCTTCTCGCCGCAATGCTTGAGCATCGCGTTGCTGCGCATGTAGTCATCGTAGTAGGACCCAGAAGAGCCTTGTGCCATCTTGTAGCTATCGC
CCAAGCAATGGCAGTTTGAAGCAGAATAACGACCGACGAGCTGGGCATTCTTGCGGCGGTTCGAGGCGTCTCGTCATTTGCCATTCGTGAAGAGTGGAAG
ATATGGCGGCGGCGGCTCCGAACGAGATAGAGGAGGTGATCAAGCAGCTCAAGAGCAAGCCTGGCTTCTCGTCCTACATCCTCATGAACAACGACGGCAT
CGTGGTCAAGTACGAGAACGTCGAGTACAAGGAGGCCATCATGCACGCGTACCACGTGCTGAGTCTCTACGGCCGCACCAAGAAGCACCTGCAGAAGCTC
TTCCCCGACCCGAGCGACAGCGAGATCGAGTGGCTGCGACTGCGCACCAAGATGCACGAGATGATCATCGCCCAGCACCTGCGCTTCACTCTAGTGGTGC
TGCAGCAAGCCGAGGCGACGGATATCGCCCCAGAACCGGTTGGGCGTGGACCCGTGGAGGAGACGGCCAACGGATCGAAGGAGGAAGAGAAACCAGTAGC
TGCTACGTGATCCTAGAAAGGAGAGGCGAGCTGACTCGTGGCACTGCGTGGGCCCAGCAGAGTGAAGGTCGTACTACAAGTCGTACTACTTGAAGTTGAA
ATCGCAACGACGTAGCGTGTTTACTTAAGAACCGGACCGGACTGAGTTTGTTTTCAAGCTGCAGCTGGTGACGGTGGATGTTGGACACAGGGTCGGCGTT
GGACACTGGTGCCAGTGGCAGCGTACAGACTCACAATCGACGCAAGAAGATTAAGATAGGCTGTCCAGCCAGCGGTTAATCTTGGTTCATCTTAAAGTTT
GGAACCTCATGGTTCTGATGATCCAGTGGGGTGGTTGCTCCGTCACTTGGTGGTTTGTGGTGGCCTACACGTTGGCGCTCGCTGGTGCTGTCAATTGATA
CCCACCACATCGCACCAAGGCGTTTTGCGTGCGTGCGTGTTGCTGCTGGAAAAGAAACGCCGTTTCTGGACAGCTCTGGATTATAGGTATATGAATGTTG
TAGGTGTCGACAGCCCGTCTCAAAAATCGTGGCGTGGCGTGGCTCTCTTACTCAGAGTCTGACCATCGCACCGATCCACGCGGTAAAGCTCAACTCTTGT
CTGCACACTGTACTAACAAAACCCTTACCGCCACACCACCAGACCTTACCACACACATTGCAACTGCCAAACCGCTGCACTTAATTAAGCTGATGTTTCT
GCCGTTCCCCGGCTCAAAACATGCGATTGCGAAGCCTTCCACCAGCGCTTCGAGTTATCATCAACGGCCCGTGATACCCACACCGACCGACTCGACTCGC
CCGCCCTCCACAATAGCACCAATAGATAGCACTTCTAAATTTGCTGTTCGAGCAGCAAAAGCCTCTTCCGACTCACACCTTCGCCAACCGCTATGGGCTT
CTTCGACGAACAAGTGGGCGTCAAGGTGCCCCAGGTCACTGTCTACTTCTGGATCATCAAGGTCCTGGCCACGACGGTCGGTGAGACGTTCGCCGACTTT
CTCAACGGAAATGTTGGTCTCGGTCTGGGCGGCACCTCCGGC