Description :
From Genome Similarity Track
Location :
Scaffold_539:4748- 7281
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_539-snap-gene-0.8Heat shock transcription factor
Pytap_DAOMBR444maker-pag1_scaffold_539-snap-gene-0.9Transmembrane protein

Sequence
2533 bases(100 bases per row)
ACCACAGGGAACACCAACGGAGACTATGAGCTTGTGTCGGAAGCGTCAATTCCCTTGTATTGATGCGGGCTCTGCTCTATGCAGTAACAATGTGATGGAC
GTACAAGAGAAGAGGAAAGCCAAGATCGCTACGACAGAGAACGCTTACTTCTCTGACTCTATCATGAGTGTGGAGGAATCACTGATGCTCGACTGGTCTG
TATGTGACTACGCTCGATACGACTGTGACGAGTTGATCAGCCGCACCTTCGAGTTTCCAGCAGAACTTATCCTCTACGAAAGTGACATCAAGGCTGTTGA
CTGGGAGCCGCTTCCGCTGGATGCAGAGAGTACAGTTGATCCAGTCGAGTGGCATGTTCTTGGCGATTTATTTCTGTAGTGATTTAAACGATGTACACCG
TTGtCGTTCTACGTAGTACTGTGCGTACACACTAACAATAGATAGCGTTTTGACAACCGGCATTCTCGATCGAAGCCACACGACAGCAATGCGGTCACGT
TGCTCACAGCAAAGCCAGAATGCGCGACGGTGGATGCTTGTGGCCACGACTGCGTTCAACTGGTGTGTATGGGGCTTCATCGCGACTCTTCTTGTGGCTC
AGATGCTCGGTTTTTTCTGGAATACAACGGTTTCGTACAGAACGATGACCCTCGGCCGCAGTCCACTGCTGCCCATGACCAAACTTGAGGGCGTCAACGA
CGAGCCTTTCGCAGACCGCGCCATTCTGTGCATGAGGATAGACAGTACCCTCATGCCTATGCAATTTAGTGCCGTGGCTGGTAGTCTCGAATATACTGAG
GGTATTGGCTCGTCCGAGCAAATCGTCGACGGCTTTCGAGCAGCCCAGCGCGAGACACCTCTAGCCGGGCTTTCCACACCTGCTCTTCAGTATTTCCAGC
GCACTTGTGAACAGATCAACGCAACACTCACCGCCATTCAAGACGGCTGTGACACTTTCGGCTTCCACACAATCCGTCGgACGCTCCACATTATAACAGG
GGTCTACGGCCGCACAGTCCTCAAGGTGCCTCTGGCACTTCCCATTGTTATCGTACCGTTTTGGGACAACGCTTTCCATGCCTACTTTGTGATCCCGGGA
AAAGATGGCATGGCCTGTGTCTTCCGGTTGAACGGTATCTACCAGTCAGAAGATACTCAATATGGAGAGCTGAGGGTTGTCACACGCACTTCAAGGGAGG
AGAACACAGTAAAATGGCTGCAAAAGCCTGAGGGAAGGTGGCGGAATGGTTGGTACGAAGCATCTGACGGAACGCGCTGGTTTTCCAACATGATGGCATC
GAGTGGCACCAATCACTACGGCATTGATGCGCGTCATTACGACACGCTCGCAAATACAGAACTTGATTGCGAGAAAGATGATGTGACAGCCAATGTGTGC
CGGCCTGCGGTGGTCACTGATCGGTGGGGAAACCAGTTCGCGATGACGACAGAGATGTACCAGCAAAGCCAGGTTTTTATCTCTAATGGGGCCCGTTTTG
GCATTTTCATGTTTGATGTGAAAACGAAGACTTCCGTCACCGTCAAGTACAGACTCGAGTCGGTCATATCCAGTGTATCCATTGTACTGATTGTCATTCG
CTGGTTTTTAGCACTTTGTGTGATGCTCCGCAGTTATCTTCTGAATGTCTCGGCACGATCTACTATAGGAATTGCGAGTGTGTCAAGCCATCGAACGTTT
AACATACTCATGGTGCTTGCACTACCTCATTTCAAGTTGACGTCTGCTGCGTTTTGGAGTGCTGGATGCTACTTTGAAGGCGAGCAGAGTGCGCTCGCGG
ACGCGTGGCTCGTCATGTACCCCGGTATCATCGAGTTTGTCTTCATGTATTtCAGCTTCCTGAACAGTATCGCGAAGGTCATGCATCGACGAATGAGCGA
CATGCTGTTCGGCCCCACGATTGGCTTCATGTGTCTATTGCACTACTTACGTTTGCCGATCGCTGACTCTAACTGGTTTGGATTTGATGGGCGTCTGACG
ACATTCATATCGTCCAACGAGTTTGAATCGCTCCCGACATATAGTTTGCTTCGGGTCGATGTCGCGATTCGTGTATGCGGCAATTCAAAAGACCTCTACT
TCGTCAAGGTCGCTGTGCTCGTTATCAACTTGGTGCCGCTTCTGTTTTCTGAGAAGATGACTGAAAAaGgTGACAAGTTTCGGCAATACAAACCATGTCA
AATCGAGGCATCTCTTGCATTACGATTCTCAAACATTGGCGgTTTGGGACGATCGGAAGTCTACTCAGCGTTTACTCAGGGCACTAGAGCGCGAGGAACA
AGTATCGCCCcTACCTGGTCCCTTGTCAAACTCTCTGCAATCACGCCAGACCAACCTCTCAAACTGTCACCCAGAAACTACCCACTAACCGAGAATCACG
TCACGACTGGTTACGAGATGTGCAGACTGGGCTACGTGGTGTTCGGTGgCAAGTATCTCGTCTCGGTTGAAGaCTGGTGCATCCTCATCTCTCCAAAACc
aTTtCGtGAGCTGGAGAAGTTgTGGGATCATCG