Description :
From Genome Similarity Track
Location :
contig_31:474687- 476236
Transcript NameFunction/comments
g7548.t1hypothetical protein
g7549.t1hypothetical protein

Sequence
1549 bases(100 bases per row)
CCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAGGACGATAAGCTCGTCGACGAACTCC
TTCTCTTGATAAGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTCCA
CCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCTCCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCT
TACCTTCAGGATGACAAGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCG
ACACGCTCGATCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTTTAGTTTTTTGATTGCCCGTGACGATACCCAGTATCGCCACGACGGCTCCT
CGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCGTAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAACCA
GCAGCTGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTGCCACCGGTCGTGGCATAGCCGTGGGGCGTTCACATGCAGTTTAGCCTG
CCGCAGGCTAAACTCTTCTTGCATTGCAAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGG
CCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCCTTTGGGCGTAAGCATGCACGTCATG
CTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTTTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCTTCGTACGTG
CTAAAGCACGTAGGATCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGA
CGATACGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTAATGAC
TCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCG
GTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTC
TGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACG
TGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGG