Description :
From Genome Similarity Track
Location :
Scaffold_96:47460- 48838
Sequence
1378 bases(100 bases per row)
TGACAGCGATCTACATCAAGAACCGCCTGCCATCACCAAAGATCCAAGACAAGACCCCGTTTGAGATCATGTACAAGTCCAAGCCAAGTGTCAAATACTT
GCGAGTGTTCGGATGCAGAGCGTATGTGCTCACCCCGAAAGAAAAACGACTCAAGTGGGACCCCAAAGCTCGTGAAGGACTGTTCATGGGATATGAAGAA
GCGTCGAAGGCGTATCGAGTGTTCGACATGGAGGCAGATCAAGTAGTGATTACTCGAGATGTCAACTTCGACGAGTCAGCTTTTGGACTCTCGCCGACGA
TCCCGGATGAAGTCGTGGAAGACGCTGCGTTGGACTTTGACTTGCTCGCAATTGTTGAAAGACCCCGTGAGACTGATTTCAAGCTGGCTGGAAAACGAAA
GGATCGCTTAAGAGTCGAAGAACAGGCCTCTCGAAGCTCAAGTCCTGTTCGTCATGGAGCTGGACTCGAAGAAGCAAGTGCTCCTGACCAAGGACGTCGA
GTGAAACGACGATCAAGTTCTCGCGTCGAATGGGATGAAGAAGAGAAGGGCAATGATCAAGACACTGAAGGCGATGCGAGCCCTCCCGAATTTGGCGTGC
CGGTGTCAACACAGTCGAAGCTGATGACTTGTCCGAACCAACGACTTTTCAAGACGCTATTGGTGGACCCGATCAAGCTCACTGGCATAAAGCTATTCGT
GCAGAGCTCAAGTCGATGCGACTTCGTGGAGTGTTTCGAGCTGCCAAGTTACCAAACGGACAACGTGCTATCGGCACTAAGTGGGTGTTCAAGATCAAGA
GAAATGCAGATGGATGCAATGAGAAGTACAAGGCGCGTCTCGTGGCCAAGGGCTTCAAACAAAGTACGGCATTGACTACATCGGGACGTTTTCGCTTGTC
GTCAAGTAAGTCACGCTGCGCATGGTTGTCGGACTTGCGAAGTGTTTCGGCTGGCCTCTCGATCATCTCGACGTGGTGACGGCGTTCCTGTATGGCGTGA
TGAAGGAAAAAGTCTTCTGATCGGTCCCCGAAGGTGTCGAGATCGACAGCGAGTTTGACTGTCTCGAGTTGGTGAAAGCTATTTATGGCCTCAAACAATC
GTCTCAAGTCTGGAACGAGACTTTTGACGAGTTCGTTTGCTCCATCGTATTTCAAGTTTCAGCATGTGACCCATGCTTGTATATCAAGACTGCGGACGGA
CATTGCGTGCTGCTACTGGTCTACGTCGATGATGTTTTGGTGACTGGAAGTTCGACTAACCTGATCGAAAGCACCAAGAGAGATCTGAAAACTCGGTTTG
AAATGACTGACAGCGGCTAATGTGCGTTTGTGCTGGGCATCGAGCTCGTGGATGGATCCGACGGAAGTGTGACGATGT