Description :
From Genome Similarity Track
Location :
Scaffold_217:4745- 6194
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_217-snap-gene-0.20Cysteine protease family C01A

Sequence
1449 bases(100 bases per row)
ACCCACGCCCGTGAGCACGATCGTGAGAATCGACACGATCACCGCGAGCGCGATCCACGTCGACGGACTCATCCCGACAAACACCTTGTCGCCGCCACCG
TCCACCACTGCAGTCGCAACACCAGCCTTCGCGCCCACAGGTACCACGGGAAAGATGTTGAGTCCGCAGTTCGCCTTCTTGTCCGCGACGAGCTTCAGGA
ACCCCTTATCGCCCCAGGAGCTACCGTATGAGTTCTTCAAGATCCAGTAATCCCCCACAGTCGCGTCCGTGCCGTACCCTACCAGCAGCAGCGCGTGGTT
CACATCGTCCTTCGATGCGAGGTCGCCGTCGTTCGGGCAGCTGTAAAACCCGCCCTTGTAGTCCTTGAACGGATCGTCCGAGTTGAGCGCCACGGCGATC
GGCTGTTCCTGCAACGCGGTTCGCAACAGCACGCTCGGGTCGCTGCTCGCCGAGCAGTCCTTGCCGACAACCTGTTTCCAGTCCGAGATGCTCGCCGCAG
TCTGGTTCGACGTCCGGATGCACGTCGTGTTACTGGACGCGGATTGGTCGTTGTATGGCATCACCAGCTCAGTCACGAGCCCGTACTGCAGCTGCGCTGC
GTCCATGAACGCGCCGTGGGTCATGCCGCCGTCACAGCCGTTGTTCGTGGACTTCCACTTGATCGTCTCGCTGAGCCACGACACGCCACTGACACCTCCA
GACGCCCAGCAGTAAGTGAACGACTGCTCGGTCTCGCGCGTACTGCACGACAGGAACTGCTGGGGCGCGAGCGCGACCGCCGCGGTTTGGTTCGCAGCGA
TCGCCACCGCTGTCTCGATCGCATCTGTGGCGGCAAACGCCCAGCAGCTACCGCAGTTCTGCTGACTCTTCACGGCCGAACAGACGCTGTGATTGTGCGG
GTTCGCTGTTGTACACCAGTTGAAGTCGCTCGTGCTTGTGGTGCTCGAACTCGACGAGCCCGTGGCCATTGTCGACAGCTGCCGCACTGACGACACTTTG
GGTCCAGCGCGCATTTCCATGTGGACAAAAGCCTCGGGCAAGTGCTTTCGGGGCGTTGTGTCGAACAAATGGCGCCCATTCACACCCATCTTGTACGTGA
ACGCATGACCCACGCTCTGCGCATAGCGGTGGACATCTACACATGCAAAATAAATCAGCCAGTTAGCACATTGTACACTCAGCCCACCCTCACAGGCAAA
CGAAACAAGACGCACTCTCGATATACTCCATGTGGCGCTGCAGGTTGCGCAGCGGAGCCTCGGCGTCGCGCTCGTCCACGTTGTTTTGCGCGAGCAGCAA
TCTGCGCAGCGCCTGTGCGTCGATCACCTGGTCGTTCTCGCCCGTCCACAGGCATGAGGCGTCGCCCCCGTGTGGACAGCTCACCAGCGTGCCGACCGAG
TTGTCTGCGGCCGTGGCGATGTCCATTGCGGCAGCAAATACGCCGAGCG