Description :
From Genome Similarity Track
Location :
contig_5:474489- 476048
Transcript NameFunction/comments
g1586.t1XP_009517863.1 hypothetical protein PHYSODRAFT_323950 [Phytophthora sojae

Sequence
1559 bases(100 bases per row)
ACCATGCCGCAACGACTGACCGTCGCTAGTGTTGCGTAACGAAGTGTCTCCGTTTCCATCATGATCCACACGTTCGGAGGAATCTCAAGGCGTTCTCCGG
ACGGAAGCGTCAACAAGCGGTTGTCATCAAGCACGGAGTTCAGGTTTTCGGCCCACTCAGGGTCCACGTCGCCATCGAAAATGATCCAGTGACGCTTTTC
ACTCTCACCTCTCACGCTGTTAAGTACTTGACGGAGCAAGTACGTGAAAACTCCGTCCGTCCACTCAAGCGTAGTGTTATCAAGAACACCATACAAGTGT
TCCTTGGAGAGAGCCTTCGGGTCGATCACGTGAGCTTCCCCCTTAACACCATCAACAAGTTCCATAGCATTCATCAACACGCGCCAGGCGCTTGACTTTC
CAGTTCCTGAAGCACCAACAAGCATCACTCCGTGGCGAAGTTGCATGACCTGGTAGAGTTGCAAGGCTTTCTCGACCCACTGGTCGTTTGCAACGTAATT
AGCATTCTTCGCCAATTCCACAATTTTGGCGCGGAGATTGTCTTCGTCAATACGATGAGCATCAGTGCCCGGGAACACCCCCTTCAGCAGTGTCTCGAAG
ACAGGTACATCGTTAGAAACCAGCTTAGGCAAAATTGTATCCGTAATAGAGCCGATTAGAGCCTTGGTTTCTAATTCCTCGATATTTGCAGGTGCCGCTC
TGTCCTGTGATTGTGTGATCTTTCGCTTGAGCTGGCCAGCACTAACAAGCACGCTCTTCAAAGCACGAAGTCCGAAGTCGTAGTGCGGCTGCTTTGAAAG
TTGGTCTTCGCAAAGGTTGAACAAGAGCACAACCTTGGCAGAGATTTGTTCAGCAGTAGTAATACCCTGAGAGAACAGCATCACCTGCGCAATCAACTCG
CGATCCGGGGCAACCATTGCAATGCTACGGAAAAGTTGCTTCAAGTTGTCCGGCAGATTGGATCGACCAGCATATCCTGGATTCATCGTCACAAAGATGC
CTACGTCAGGATTCAGCTTTACACTCTTGCCCAGCAATTCGATGGTAGTGCTGGAGCCGTTTGTGATTGTTTGCGAGCTGTCAGCCGTCTTTCCGACCTT
CAACGACGACACTCCACTCTGGATCGCCAAAATTTGCTGAGAAACAGCAGATAGCACACGCTCCTCCAAGCGGTTAAACTCATCGAAACATCCCCATGCA
CCAACTTGGCACAAGCCCACAAAAATCCGTCCCATCGCTTGGAAATCGAAGTGTTCGTCACAGTTGAAAACCAACACAAAACGACCCAGGTGGGATCCCA
AGGCTTTAACTGACTCCGTTTTACCTGTGCCGGCAGGGCCAAACGGATTACCCCCCATTCCGAAGTCCAACGCCTGAGTCAGTGTGAGGTAGCAACGCTC
TGTGAGAGGAGTTTGCACCAGTCTCTCACCAACACCGAAGTACTCAAAGCCGTACGAGAAGCTTGCATTGGAAATTTGGATGGTAAGTTTCTTGAGCGGG
TCCGACTCCTTAGCTTGGAAGTAATGGCGCATATGGTACAACCAGCGGAAGTCCTCAGC