Description :
From Genome Similarity Track
Location :
contig_5:474454- 476013
Transcript NameFunction/comments
g1708.t1RAW42921.1 Dynein heavy chain, cytoplasmic [Phytophthora cactorum

Sequence
1559 bases(100 bases per row)
ACCATGCCGCAACGACTGACCGTCGCTAGTGTTGCGTAACGAAGTGTCTCCGTTTCCATCATGATCCACACGTTCGGAGGAATCTCAAGGCGTTCTCCGG
ACGGAAGCGTCAACAAGCGGTTGTCATCAAGCACGGAGTTCAGGTTTTCGGCCCACTCAGGGTCCACGTCGCCATCGAAAATGATCCAGTGACGCTTTTC
ACTCTCACCTCTCACGCTGTTAAGTACTTGACGGAGCAAGTACGTGAAAACTCCGTCCGTCCACTCAAGCGTAGTGTTATCAAGAACACCATACAAGTGT
TCCTTGGAGAGAGCCTTCGGGTCGATCACGTGAGCTTCCCCCTTAACACCATCAACAAGTTCCATAGCATTCATCAACACGCGCCAGGCGCTTGACTTTC
CAGTTCCTGAAGCACCAACAAGCATCACTCCGTGGCGAAGTTGCATGACCTGGTAGAGTTGCAAGGCTTTCTCGACCCACTGGTCGTTTGCAACGTAATT
AGCATTCTTCGCCAATTCCACAATTTTGGCGCGAAGATTGTCTTCGTCAATACGATGAGCATCAGTGCCCGGGAACACCCCCTTCAGCAGTGTCTCGAAG
ACAGGTACATCGTTAGAAACCAGCTTAGGCAAAATTGTATCCGTAATAGAGCCGATTAGAGCCTTGGTTTCTAATTCCTCGATATTTGCAGGTGCCGCTC
TGTCCTGTGATTGTGTGATCTTTCGCTTGAGCTGGCCAGCACTAACAAGCACGCTCTTCAAAGCACGAAGTCCGAAGTCGTAGTGCGGCTGCTTTGAAAG
TTGGTCTTCGCAAAGGTTGAACAAGAGCACAACCTTGGCAGAGATTTGTTCAGCAGTAGTAATACCCTGAGAGAACAGCATCACCTGCGCAATCAACTCG
CGATCCGGGGCAACCATTGCAATGCTACGGAAAAGTTGCTTCAAGTTGTCCGGCAGATTGGATCGACCAGCATATCCTGGATTCATCGTCACAAAGATGC
CTACGTCAGGATTCAGCTTTACACTCTTGCCCAGCAATTCGATGGTAGTGCTGGAGCCGTTTGTGATTGTTTGCGAGCTGTCAGCCGTCTTTCCGACCTT
CAACGACGACACTCCACTCTGGATCGCCAAAATTTGCTGAGAAACAGCAGATAGCACACGCTCCTCCAAGCGGTTAAACTCATCGAAACATCCCCATGCA
CCAACTTGGCACAAGCCCACAAAAATCCGTCCCATCGCTTGGAAATCGAAGTGTTCGTCACAGTTGAAAACCAACACAAAACGACCCAGGTGGGATCCCA
AGGCTTTAACTGACTCCGTTTTACCTGTGCCGGCAGGGCCAAACGGATTACCCCCCATTCCGAAGTCCAACGCCTGAGTCAGTGTGAGGTAGCAACGCTC
TGTGAGAGGAGTTTGCACCAGTCTCTCACCAACACCGAAGTACTCAAAGCCGTACGAGAAGCTTGCATTGGAAATTTGGATGGTAAGTTTCTTGAGCGGG
TCCGACTCCTTAGCTTGGAAGTAATGGCGCATATGGTACAACCAGCGGAAGTCCTCAGC