Description :
From Genome Similarity Track
Location :
contig_7:47443- 48983
Transcript NameFunction/comments
g1991.t1hypothetical protein

Sequence
1540 bases(100 bases per row)
CGCGAAAGCGAGGAATGTAGTAACTAAGACAGCTGAAGTGACAGCTCGCATTTTCTGGGTGCTGTGGACGCAAGAAAAGAAGTTATGGCATGGCCTCTCA
TCGCTAAGCAGGGAGAGAAATGAGGCAGTTGGCAGATCGTTGACGCTTTCCTCGACGGATCATTATTATCAAGAGGCGAAAGTTTGATTATGAATCTCCG
TCATTAGCATAATTGTTGATTGTTGATGGTGCCATGTACACGTTTGTTGTGATGAACGACGCCAGTAGGAGATTGCGTGAAATTCGATAGGCGACACGGA
CTTCAATCGTTTACAATTTGATGAACTCGGAGATGTGCGAGTGCTGCTGTGATTCCTGGCCCTTGGACTGGTGCATCATGGGCAGTCGCTGCAGCTTGAT
GCAGCGCAAATGTGCTTCCAGTTTCGGTTGGAAGAGATTAAGAGCTCCTGTCAGTGTGTCGATGTCACTCGGGCCTATCAGTGAGTTTCCACTGAGCAGG
AGCTCCTCCAACGTAGCGTTCCCTGTTGCAAATTGGACACCATCGACCATCTCTAGCACGGGTAGACCAAGTTGTGCGATGGCTGTGGCTCGATCAATCT
TCTTTTTGGCCTTCTTCGCATGGTCCATCTGAACAATTGCAACCCGAATGAGAATGTTTAAATGGTACAGGCCAGCGGGGTTTGGTTCCTAGCGTACCTG
AGCATGGATTTGACCTCGGCAGCGTCGAGCTCTGCCAAAAGCTCTGGTGGTGCTACGTATTTTGTAAGTCCATCAACCAACAACTTCGCTCTAAGCAGCA
GCACAAATCGTGGTAAGTAAACCAGGATCAAAAGCATGGGTCTCTGGAGGTTTGGCAACTTACCCGCGCCCGGAGATCTTGTTGTTTGCGAGTGAGAGTG
TCTTGAGTGTCGAGTTGAACGGCAAAGCATGTGCGAAGGCCCGCGCTCCAGCATCGCCGATAGAGTTCTGAAAGAGATTGAGAGCTTCAAGTGTCTTGCT
GTGGCGAACTGCTCGAGCCAGCGCTACTGCTCCCCGTGAGGTTATTCCATTCGCACGCAGCGATAGAAAGAGAGCGCTGATTCCTCGCTTAGTAACTGGG
CAAATACTTCCGACGTGTCGTCCTCGCCTCCAGTTTCCAGCTCCTGTTTCATACTGAGTTCATGTCTTTGATCCTCACTCAACTCTTTTTCTTGGTGTGC
TTGATCTCTCACTTGCGGTACTGTTGGGTGTTGTTTGCTGGTAGCACCACCCGAAGGAGGTCTAGAAGTTGTCGGAGGAGCTGAGGGTGGCCGGGAATCT
CCACCAGAAGGTTGAGGAGACTTGACACTTGGAACTGGAGACTCCGAAACACTTGAGGTGCTGGTGGGGCAGAGTCGAGTGGGTTCCATTCCAGTTGAAG
AGCGGTCACGTGCGTCCTCGGAATCGTACAGCATAATAATGCTAGCTGCTCCTTGTTCAACCCGACATTAAAGAGGCTAGGCATTGACGCTGGTCAGTGC
ATACGAAGCACTAAAAGATGCACGTGACGTACCAAACAGA