Description :
From Genome Similarity Track
Location :
Scaffold_97:47433- 53457
Transcript NameFunction/comments
Phyin_T30-4PITG_19417Putative uncharacterized protein

Sequence
6024 bases(100 bases per row)
AGCGGCGGGTTGCTCGTAGTATACGGATGTGTACGGGGATACGATCATCCCTTTAGAATCTTGATTGACTCTGGGGCGTCGAAGAATTTCGCACGCCGCC
AGACGGTTGCTCGTAACAGCAAAAAGTTGTCCGAAGCTTTGCGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAGGTCGTCAC
TGTCCCCAACGTCAAAGTGGATCTGGCTGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATCCATATGATATGATCCTG
GGGATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGGAGGCCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCATTGGTGAG
TCATGTTCCCACCTCTGTCAAGACCCGGGGGCGCCCGCGAGGACTGGCAGGGTACCAAAGCATCCGGCAGACGCTTGGGACTCGAGGGACGGTATGTGAT
CGACTTCGAGTATGTGTTGGTGGCGGGGGAGGGACTAAAAAGGGGGGTGGCGGCGGGCGGTAAGTAAGGGCGCACGAGGGGGAAAGAAATAGCGCTACGA
GTGAGATTGCGAAGAACACGGGGATGAGAGTCAGACTGCACGAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTAGGAAAACGTTCCAATAGTCTGAACTTGA
AAAAGCATTTGCCACTCCGCTTGGGATTGTCCCAAGTGTCGGTCGCCCCAGCGTTCTCCGAACTCCGCCTTCGACTTCCGCACTTGGAAGCCACGACCCG
GTCAAAGCCTGCAGCAGCGGCGGCACCCGACGGTTCCCAGCTGCATCCCGCTCAGCACCCGACGGTACTCTCCCGAATATGCACTTAAAGCCGCGGAGGC
ATAGCGTGATTGTTGGGGACGATCCGGTCCCGTGACCCCCGACTTAGGGGGTCGTAGCAGACCAGCAGCGATTTTGGGCTCTGTCTTGATCTGAGTGTGC
GACTCGCCGACCAACACTCTCGGCTTCTCGAGAGCTCCAACTGTGTGTTCTGGATCGTTTCGAGCTCCAGATCAAACAGATCCTTCGCCGCAAAGGGGCC
TGGCGTGACACCGGTTTCTTTCAGGGGAAACAGTATGGCTTTCATAGCCTCCAGCTTGTTCGTCGTCTCAGGTGGCGGTGTCACCGGTCCCTTCAGCGAT
CCAGATATCTGCGGCTGTATGATCCGCATCATTGGGTTCTTGGCCATAAACCTTGAAGTTCATGCTGGTTGTATTCTTCTTCCGACTGATCGTCAGACCA
GGTCGCTGCGATCTCACCGAGGCTATCGGGGTCTGAATCAGCTGGGGCCTTGAGCTTCTTCCGCGACGCGTACGAATTCTTGTTCTTCGGGGTCTTCTGC
GTTGGCGGAGCGGTTGTTGATGAGGTTCCCTCGGTTTTCACCTTAGGTTTCTCATCGGGCAGATCACGATTCGCATTGCGATCTGAGGTGCCTCCAGAGG
AGGCATGGGGAGGAGGTTGAGGCTTCTCTTCAAGAAGATATGATCCTTCGTTTCTGTCGGCAGAGCTCCTCCCAGGGCTATGTCGAGCTGCTGATCCTGC
TTCATACAGCAGCGTTGTCGGCGATCAGTTTCCGATGACGCTCCCATCCTTGGTTCCAGCTTGATTAGCACTTCCTCTTCTTCTTGGGACTCACGGTGTA
ACCCCGAGTCACCAGAAGATCCGGGCACGCTCACCATTGTGGTGGCGTGGCTCTTAAAAAACTTACGATCCAATCTCACACACCGTGCCCCGGACTACCG
ACTGACGGAGGGGGTACTCCGAAACCGTGGGGTTGCTGAGGGCTCACCTTGTGTACCCGTCGGTGGGGCTGGTAACACTCCTCTGGTGGACTTGAAGGGA
AGCTTGGCTTGGGTTGGTTCTGTCTTGGTGGAACGCAGGATGGTTGGGGGTGGCGTAGCGCGGAAACTCTTCAGGCTACGCGCCAGGTTGGTTGTCGACC
TTGATCGACGTGGGGTGTTGTTATTCCTGTACGGGGTCTTGTTCCTTTCCTTGCTAGACTTGGCCGCTTCCTATAGCGAAGGGCGTTGAGGGCGAGAGTG
AAGGCGATCGACCAGTCAAGCTGCAAACTCCGGCGACTGACACGTGTACCTGGTAGACTTAACTTGATTTCTGTATGGGTCAATATACCCCCCCCCCCGC
TACAGCCTCGAAGTCTGTTACCGAAGACACTTGTTGCTGATGAGGCAAATTCCACTCTGTTAAAATTTAAAGTCTTTGCGATCCACTACATTGCATATCC
TATGATCACCAAAGTGGCCCTTAAAGGTAATATCGTACTTACCCGGCATGGGTACAAATCAGTCGATGTACTTTGTAGATCGTGTATCAAAATGACTGTA
CCTTACCGATCCGATATCGCTGATTGCGTATGCACGCGCTGATGCGCCTTCGTCACTGGTGGCATTCCAAAACCCGATAGGGTCGTATCCCATCAATCCA
CCTCCCAACTTAACCAACGGGCGCTTCACCACACCAGCAGCAGAAGTAGCATGACTTGTCAACACCGTATCAGCCCTTGATGTCGTATACCTCCTCTTCC
TTAAAGGGTCGGGTAGTCCGCGGCTGTTTAGGGAGTACGGTCTTGTTTAGTGGCTGCAGGAACGGTAGATAGGAACACTTGTAAGATGACATAGAAGTTT
GGTTATTGGCTTGGATTCCTCTTGAGTAGAAGGAGGGAAATATAAGACTGTGAGCTAACAGGAAGAGAGGTCTAACACCTTCTCGACCTTACATACACTA
AACTACCTCTCTTATACTTAAAAAAAGAGTTCACTTCGTTTGTCGTCAGTCCTCGTGGGACAACGGGGAGCTCTGGGAAGGGGCTTGATGACGCGAGGTG
CTTTGGTCCCACGACGCCAGGCCACCGGCGTTCTGAGACCACCTTATATGACCACCCTAACGGGCTTGGTCAGGGGCACGTGGGTCGTCGGGCTCAACGG
GAACCACCCTGCCGGGACGGCCGGGCGAGGAGTAACTACCGGGCCTCGAGTCATCCCGTCGGGAGGCAGAGCTCCTGGAATGACCCCTCCGTTCCGGGAT
ACGGGACATCCTGTGGTGTAGGGATTTCCAGATTCGACCATACGCCGACCTACTTTAGGTCAAGAATCGGTTCGGTCTGATAACCCAGAGCTTAGGAACA
AAGGATCACGGTAAGTACTCGGCGATCTGTCCGGATATGCTATCCGGACAGCCGCTGAGCTCAACGGTCGCCGGAACTCAGCTGAAGGGTCGGTAGAGAT
CCGAAACGACTACATTTCATTAGATATTTGTATGAGAAGCATAGGATTAAATAGGGGGAGCCGAAAGGGCTCCCAGAAGATAACAGAGCAGAATTTTCTT
AGTCCAAGACACGTGTACACTTTTCCGGTAAGTCCCTGCATAGGGCTGGATTATGCCTGCCGTCAATACTCGAGAGGCATAGCTTGTAGGGTATTGACTG
GTAGCGCCAAGAGATTAGGTCGGTCCGGGTAGGACAAAGTCTCGCTACGCGCGAAAGAAAGTCCCGCATACTCAGCGGGCCGGTACGTCGGATAGCCCGG
GTGCCGTAACACTTCTAGCTGAGCTGCCTCTGCGCTCGGTGACCTGTAAAAGCGCTCGCGCGCCGTCGTCCATCCTTTGGTGGAGGGCACAGGGTTGTGA
ACGAGCTCAGCCGAACCAAACTCGGCGGAGCCTCGGAAGTGATCTGACTTGGTTAGTCGGAACCGGGTGGAAGCGAGCCACTCGTCTGTCCCGGAAGGGC
CGGACCGCGAGGGGACCACCCTCTGCGCAGGCCATACAAACCGCCGACCTAACTCGGCGATTCGTTGTGGTTTGTGTAAGGAATCCACATCTGACGATAT
TTGTGTGTTCTACTACACCACAACTGGTGCCGCGACCCGGGAACAGGAGTGTGTGCTTGTTTTTATAGGTGCCAGCTAACCAAGTTAAGAGGAAGAGAAG
AGAAAGAGAAGAGTGAAGATGGTCAAGGGATCAGCAACTCCGAGCGACGGAAGCCCAGCGACGGCTGGAGGATCGCCTCTCGCGGGGTCGGACCCGGCGG
ATCAACGACTCATCGCCATGACGATGGAGGTGGGACGAACCGTCCAGTTCGACGAGGATGGCCAAGACCAGGAGAGCGAGAACGGAGATGCAAGTGAAGG
AGAGTATGAAGAGAAGGCCGAGAC