Description :
From Genome Similarity Track
Location :
Scaffold_495:4743- 6620
Transcript NameFunction/comments
g17284.t1hypothetical protein

Sequence
1877 bases(100 bases per row)
GAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCT
GCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAG
TCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACC
ACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGGCGCAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCG
ATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCCCTCACAGCGGTAAGCACTC
CGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCG
CGACTTCGCACCGAGCTATTTCGACGACGTGTTCATTCACAGCCGGGCTGTGAATGGGAAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTG
CTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACG
GCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAATGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTT
GTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCC
TTCGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCCTGGCGGTGGCCGACCAAGATCCCCATTCCACGTGGTGTGCGATGCATCCGATTTCGCGAT
CGGATGCGCACTGATGCAACTCGATCACGGAGGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACAT
GACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGC
GTACGGCGATCAAGTCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGGTT
GAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGTACAAGAGGCCGACGCCAACTGCGTTGGCGTCGTCAGGACGACTACACCCTCGTCG
TCCTTGCTGGACGAAGTGAAGGCCGCATACGCACATGATGCGGATGCGAAGCAATTGGTGGAGTATTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGC
TGGCCAAACACCTTCGTGCCCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCC
GGATGATCATGAGCTGAAGCTCAAGATCACGTACGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGACATATTTGCTTCTCACGCGT
GACTTCTATTGGAGTCACCAGTACAAGTGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGCGTGAAGCC