Description :
From Genome Similarity Track
Location :
Scaffold_80:47419- 51760
Transcript NameFunction/comments
Phymu_g3703hypothetical protein

Sequence
4341 bases(100 bases per row)
CACTTTGCACCCAAAAGACCCACACGGCGGAAGGAAATGCATGTTACAGAGTTCCCATCCTAAAACTTATCCTGCTGTTTTCGAGAAGCACGGTTGTGGT
ATGCAAGTTGGTGGCACATTTGTACATTCTTCCCGCGTTTCCACAAATTATATCGCTTTATGTCGCTAGCACCACAATAAAACGCTGTGGTTTTGAATAG
TTTGGCAAACACATTTTCCACATCTCGTGGTGCTTCCGATTTTCGATCGAGCGACACTTCGAGCTCATTTCCTCTCTGCGGTGTTCGAAGCCTCGATGAA
GCTCGTCCAACTTTTCGCGCTTGTATCGGCAGCGGCGACGCTATCTACGAGCGCGTATGGATACTCTTTCAATGAAATCGTAGACAAGAGTGCCGCGCCC
GTCGTCGAGGTCAGCACTGGCCTAACTACGGACCAAGAGAGCCGCATCATTGGCGGTGCTGATGCAGACATCGACAACTACCCCTACGTCGCGAGTGTGC
GCATCGACGGCATCACTGTCTGCGCTGCCACACTCGTTGCCCCGCAGTACCTGCTTACATCAGCACACTGCATTAAGACCAGCGAGTTCGACATGACTGC
TTCCTTTGATACGGAGTACAGTTTCGGCACGGATGGCGACGTGGTGAAAATTGTCAAGGGATTCAAGCATCCTCTATTTAACAAAAGGAAGCACCTGTAC
GATGTGGGTCTGCTGAAACTAGAAAAACCGAGGACTGAAAAGCTTGCGGCTCTGCCTGCCGCCGATGGCTCGGACGAAAAGGTTGGCGCAAAAGCCACCG
TTCTCGGCTGGGGGCAGACGAAGGTGGCCACCCGCAGCTTCAAGCTTCAGCAGGCCAACATCCCTATCATTTCCACCACGGAATGCGGTAAGTTCAAGTC
GTACAAGAATCAGCTCACAGAAGGGATGATCTGCGCTGGCAACGGCAAAGGCAAGGGCTCGTGCAGAGGTGATACTGGAGGACCTCTTATCGCGAACGAT
GTTCTGGTGGGGTTCGTGAGTTGGGCTGGCGGCAAGTGCGGCAAGGAGCCGGGTGTGTACACCCGCGTATCGTACGTACTGGACTACATTAACGATATTC
TTGCCGGTGGTGATGGCAAGAAATTCGGTTCAGGAGGATCGTCCTCGGGCTCGACGATGGAAGAGGTGACAGTCCCTGGATCAATGAAGGGATCTTCAAa
gtctgctccagcatcaacgaGCAAGACTGCTACTTCGAAGACTACCAAGAGCACGCCGGCTCCTGCTACAGATCAAGCGTCTACAACTAAGGGGCTTACT
TTTTCGTTTGATGGATCTTCATCAGCAGAGAAAGACACCGCTACCCAGACCAAGGAAACTGGTACCACGAAGCAACAGTAGTTGGATAACTAACCATAAC
GATGTTTTTGCAGTGTTATAATTATGTGGGCGTTGGGGTTTCATACTCTGGTTGCCAGAATGGATTGGGTTGCGTTTGGTCCTTGTCGACGACTATAATA
CAGGTACCCGGATATGCACTCAGTGCATTGCACTGTACTTTGCGAAGGCCTAAGGCAACCAGTTCAGGATCCCGCATCAGGAATGCTGCTTCAAGGTAGA
AGAAGTGTTTTACCCGAGGTACCTCTCTTGAATTTTTTAAAGTGCTTTTTACATGCACCGAAAAATGTGGTGGTGCTGTCCTGTCGAGTTTGTGTCGCTG
TTGTAATGCATACCCAAAACAATTCTTTACCATGTTCATGAGCGAATTTATCATAGAGATGGTGCTAGAGAGCTTTCTCGTTATCTCGCGGCAAGGCAGC
CACACCTTTGCTCCATTGTGGCTTTAACTTTCTCGACACACGCACTCCACCGTTTGGCTGGCTATGAAGTGTTGGCGAATCACTGGTGCTGTCCTTGCTT
CGATTCTATCCGTGCTGCCCCCATCAATCTATGGCTATGAGTTTTCCACTCTTCCGCCAGTTGTTGAGCCCAACACCAGCACGGGGTTGTCCAGCAACCA
GGAAAGCCGCATCTACGGCGGTTCAGAGGCCAACGTTAACCAGTACCCGTTCATTGCCAGTTTGCGCTTTGATCCCGCTGGGAAGACATTCTGTGGCGGC
ACGCTAGTCGCATCCCAGTACATCCTTACGGCCGGACACTGTATCAAGACCAACCAGGGACAAATTTACGCTTCGCTTGGATCAGAGTTCGGCTCGGGCG
ATGGATCCGGTTCAGCTGAGCTCGTTAAAGTAGTCGAGGGCTACCGACATCCCTTGTACAACAATGACAAGCATCTGTACGATGTTGGTTTGCTGAAGTT
GGAGACGCCTTCGTCACAAAAGACAGCGCCTTTGTGTGCAGCTGATGGATCAGACAACAAGGTTGGGACAATGGCTACTGTTCTTGGCTGGGGGCTGACC
GAAGACCGAAAAGGAAGCTTCACGTTGCAGGAAGTGAATGTGGGGGTCATTTCGAATTCGGAATGCAACAAGAAATACGGGAATCGCATCACGGAAGGAA
TGATTTGTGCTGGGAATGGAAACGGAAAAGACTCGTGCAATGGAGATTCAGGCGGTCCTCTTCTCGCAAATGGCGCGCTGGTTGGCCTTGTGAGTTGGGG
TGGCAAGTGTGGATCGAAAGCAGGGGTCTACACTCGTCTAACGTACGTTATGGACTATATCAATGACGTTTTGGGCGGCGATACGGGTAGCGTTTTCACC
GGAAGCTCTTCACTATCTACGGATACGCCACCAGAGTCGCCGAGTACGGGGTCGTCGGATGCAGATGAACCCAGAAAACCTGCCGATACGGTCGCAAGCG
AAGAATCACTTTCGGTTAACTCTGGATCGCCGGCTAGTACCGGTAGCAGCTCTAATGGCGAGTCACCGTTGCATTTGACTACAGCAGCGAGTGGTTCTTC
CCTTAGCGGTAAAGTTGTCACTACccaagctcctgctgctgatgcaACAAAAAAGGTTACAACATCAGAAAGAATTTGTAAGCGACGATTCTTGGAGACC
AAGAATTAGGCACGACTCGCGTGTGTTTAAAATGTTTAAATAAAAGTGTGTAAGTGCCGTGAATAAAGCTAAAAGTGAACTCAAAACTACTAAGTACCGG
TACAGGTACAGCAACAAAATGAGTTACCAGTATCGAATTGGAAGAAATCTGCACGAAGTACATGTTCTACTACTTGTTTTTTATGGGAACGAAATGTATg
atatacatgtacgagtCGTACGACGTCTTCGTGCCAAAGATAAAAATGCTTGGTACGAAGATCTCAAACAATGATGAAAAAGATGCAGTTATCTCGTGAA
GACAACCTGCGGAAGAAATCGAATGACGATGTTTATCAAAGTACACGCACTTGTCTGTGGAATAGCCATACCGTGTACAGTATCTGTACGTAACGCTACA
GGGATTATTGTATGCCGGCCTGTTATGGCCGGCATACAATAATCTTCGACTCTGCATTGCGGTCACTGTGGACTCCGCAGTGCGGAGTGCAGCGCTCCCA
TCTTTTGCTTTTCCTGCGATGCAATGAAACATCACCAGCCTGCCTGCTGTTCACCCGCATTTGCATGGGCTTTGACTGCGTTCTAGCTGGTGGCGTGTAG
CTTACGCTTATCGTCCCCATCAACAGATCTCCACGAATACCGATAGCAATTTTGGCTAGCGCCACAGCCTGTTAGACTTCCGGCCTGTCCGATAGCCCTT
TTTGGATGCAGTTCGGAACGTATGGAATCTCGGACAAAATGCTGGCATAATGTCCAATCTGGTCACTTTTGCTTTCCCCACGCCGGACCATCACACCGTT
CTCGTGGTAACGCTTCAATAAGCTGAAAAGGATGAAGGTTGCACAGGCTAGCGCGTTCGTCGCAGCACTGGCCTCGTTGTCGACTTTCGTGCATGGTTAC
TCGTTTTCCGACGTTTCCAAGACTGTGGAAGCCCCGGAGGAGAGCACGGGTTTGACCACTAACGAGGAGAGCCGTATTTACGGTGGTTCTGAAGCGAACA
TTGACAAGGTCCCGTTCCTCGCCAGTCTGCGTGATCCGTTCTTAGATGAGACGTTTTGCGCCGGTACTCTCATTGCCCCGCAGTACATTCTTACTGCAGG
ACACTGCATTAAGACCGACTCTATGACTATCATTGCCACGTTCGACACCAACGACAGCACTGGATCGGGCTCGGGCTCGGACGAAGCCACCAAGTTTGAC
GTCATGCAAGGTTTCCGTCACCCcctgtacaagaagaaggagcatCTGTACGACGTAGGTTTGCTCAAACTGGCGAAGCCCCTCAAGCGCAAAACAGCGA
AACTGTGCGCTACTGACGGATCGGACAACAAGGTGGGCCAA