Description :
From Genome Similarity Track
Location :
contig_126:47418- 51260
Transcript NameFunction/comments
g11490.t1hypothetical protein
g11491.t1hypothetical protein PHYSODRAFT_338978
g11492.t1hypothetical protein PHYSODRAFT_510782

Sequence
3842 bases(100 bases per row)
CTTGAGTGTTTTGGACGTCCGGTCGACTGAGCAGTCTTCGAACTCCGCTTGATGACCTTCTGTAGTTCAGCAGCACACGTCGTTTGAGCTTCTAACCCAC
CGGCAAACCAATACAATAGCGCTTCCTACCTTCTTTAAGGTAGTGCGAGGTCGGCGCGGTACGTGAGCGTCGTCGTGTTTAAACTCCTCTTCGGTTGCGA
AGCTAGAAACGTAGCAGGAAGATGCGACGGATGATTTCGACGATGCCTTAGAACTGCCTGGGAACAGAGCTCGCTGTTCCTCTTCAATTTGTGCCTTCCG
GTGCAGTCGCTCTTCAAGCTCTCGAATCCTATCTTGGTAGAACAGCTCGTTATTCCATCCTGCTGCTCTCTGGTAACAGGGCAATCACCAAGTCAGTGCT
CGCTTTCGCAGAATGTATCGAAGGTCACAGTACTCTTCCTGCCTTCGTGGATTTGAACCAAAGCTACTGTGGGGATCTTTGTCGAGAGTTCGTTCATCAA
AAGGACTCGTCAGTCTCTCAAGCAACTCTGGTTGCCGTATTTCCGAAGTTTGCTGTGAAACCACTTGGCCCAATACCCCCGAGATGGCTCGGCTTCGTTG
CACCTTGTCTATTTAGTTCAAGAAGATCGCAAAGGTTAGGAGAGAACGCGGTGACCAGTCCGCAGCACTTACGCACGCACCTCCAGGGATAAGACGGTGT
GCTCCAATATCCGTAGCCGATTCTCTAGAGTGGCGGAAAACGCCATTGCACGGGCAAAATGAGATTCGGACTCTTTCCTTGCTGCCTGGAGCTGCAAGCG
ACGACGGAGAAGGAAATCAGTCCACTTCATCTAAAACGTACGACCCGCTTTACTTCCTACCGTGCGTTCTGTTGTCATGCCTGCACCTTGCTGGATATTT
TCTCCGACGTCTTCCAGAGCGGCAAGCATTCGCCTCCTCTGACAATTAGCCGAGCAGCAACCAGTTAGCCGCCATGGAACAGCTCCAGCTTATACACAAC
AAACCAAATCATCTGTGCGAGCTTCGAACGAGTCTTCGGCAGCAGCCATTCTGTCATCTAGCTTGGTGCAGCGGTCTTCACTCGCTTGCTGGGATTCCAG
AGCACACGCTTGGAGGAGTGCAGTGCATTTTTCAGTGCATCTTGTCTCTCTCGTAGGTCCTCGACTACAGTCGCCAACGTCTCACTGTCCTCTTCAGCTA
TAGCAGTTCGTCCCCTCTTGACATCATCAACCTCGGATGGAGCGCCACCACAGTTCCACTGAGAAGATGCTGGGTGTCCAGACACTTCTTCAGCACCCCC
TTCACTTCTGTATTCCCGTGCTCAAGGCCCTGCTGCATCTGGTTGAGACGTTGTTGCATCTCACCAACATGCGCCTCGTATCGACCTGTTCTCTCCGACG
TCTCTGCTCGCCAGGAAGCGTCAACCTGGTGCACTAACTGCTCCAAATCGTTGCCCTGAGGTAGCACACGCATAAACCGTCAAAGAGTTCTTCGTGAATC
ACTACAAGCCAAGTATTAGCGAGTCTTACAAGTTGCGCCACCGTTCTTTCTAGCTGGAAGCTCTTCTCCGAAACAGACGAGCGTACGAGTGCCAATTCCT
GCATCGTCAGGAGCCCAACATCGTTAGCTATCCACTCCACCATCAAATATGCCGATATTCACCCACCTTGTTCAGCTTGTGCGTTGCTGTGTCGGCCAGG
TTTGCCACCTTACAGTCCGTCGCGGACTGACACGACTGAATCTCCTCAATTCGGGTCTCAAGAGCGAACACTTGCGCCTTAAGCTCCTCGATCTCGTGCT
CTGCTTGATGTTTGACGTCGTGGAGTGCGGCATCGTTCGTCTCTGCGAGGCGTGGCAAATACTCCTGGCACTGTCGAAATTGATCCTCCAACGTGGTCAT
GCGGGGCTGCTGGCGCTCCAGCTCGGCTGAAAACTTGTCCATCCAGGCGTCCACTTTGGCAGTGTGTCCTGCGAGTTCGTTCTGCGTCTGCTGCGTCGTC
TGCTCCACGTACTCCTGGTTGAGTCGGAAGACCTTGGAGAGAGACCCCACCTTCTGGTCGTTGGCTAGCTGCGTGCTCTCCAGCTCAGATAGACGTCTCT
CGAACGTCTGCGTCGTCAAGCACGCAGCCGAGACTCGCTCCAGCTGCACCTCGAGGAACGAGATGTAGGCGTTTCGATCCGTCAGCAGCTTCTTCGTGTT
CTTCTCGCCGCAATGCTTGAGCATCGCGTTGCTGCGCATGTAGTCATCGTAGTAGGACCCAGAAGAGCCTTGTGCCATCTTGTAGCTATCGCCCAAGCAA
TGGCAGTTTGAAGCAGAATAACGACCGACGAGCTGGGCATTCTTGCGGCGGTTCGAGGCGTCTCGTCATTTGCCATTCGTGAAGAGTGGAAGATATGGCG
GCGGCGGCTCCGAACGAGATAGAGGAGGTGATCAAGCAGCTCAAGAGCAAGCCTGGCTTCTCGTCCTACATCCTCATGAACAACGACGGCATCGTGGTCA
AGTACGAGAACGTCGAGTACAAGGAGGCCATCATGCACGCGTACCACGTGCTGAGTCTCTACGGCCGCACCAAGAAGCACCTGCAGAAGCTCTTCCCCGA
CCCGAGCGACAGCGAGATCGAGTGGCTGCGACTGCGCACCAAGATGCACGAGATGATCATCGCCCAGCACCTGCGCTTCACTCTAGTGGTGCTGCAGCAA
GCCGAGGCGACGGATATCGCCCCAGAACCGGTTGGGCGTGGACCCGTGGAGGAGACGGCCAACGGATCGAAGGAGGAAGAGAAACCAGTAGCTGCTACGT
GATCCTAGAAAGGAGAGGCGAGCTGACTCGTGGCACTGCGTGGGCCCAGCAGAGTGAAGGTCGTACTACAAGTCGTACTACTTGAAGTTGAAATCGCAAC
GACGTAGCGTGTTTACTTAAGAACCGGACCGGACTGAGTTTGTTTTCAAGCTGCAGCTGGTGACGGTGGATGTTGGACACAGGGTCGGCGTTGGACACTG
GTGCCAGTGGCAGCGTACAGACTCACAATCGACGCAAGAAGATTAAGATAGGCTGTCCAGCCAGCGGTTAATCTTGGTTCATCTTAAAGTTTGGAACCTC
ATGGTTCTGATGATCCAGTGGGGTGGTTGCTCCGTCACTTGGTGGTTTGTGGTGGCCTACACGTTGGCGCTCGCTGGTGCTGTCAATTGATACCCACCAC
ATCGCACCAAGGCGTTTTGCGTGCGTGCGTGTTGCTGCTGGAAAAGAAACGCCGTTTCTGGACAGCTCTGGATTATAGGTATATGAATGTTGTAGGTGTC
GACAGCCCGTCTCAAAAATCGTGGCGTGGCGTGGCTCTCTTACTCAGAGTCTGACCATCGCACCGATCCACGCGGTAAAGCTCAACTCTTGTCTGCACAC
TGTACTAACAAAACCCTTACCGCCACACCACCAGACCTTACCACACACATTGCAACTGCCAAACCGCTGCACTTAATTAAGCTGATGTTTCTGCCGTTCC
CCGGCTCAAAACATGCGATTGCGAAGCCTTCCACCAGCGCTTCGAGTTATCATCAACGGCCCGTGATACCCACACCGACCGACTCGACTCGCCCGCCCTC
CACAATAGCACCAATAGATAGCACTTCTAAATTTGCTGTTCGAGCAGCAAAAGCCTCTTCCGACTCACACCTTCGCCAACCGCTATGGGCTTCTTCGACG
AACAAGTGGGCGTCAAGGTGCCCCAGGTCACTGTCTACTTCTGGATCATCAAGGTCCTGGCCACGACGGTCGGTGAGACGTTCGCCGACTTTCTCAACGG
AAATGTTGGTCTCGGTCTGGGCGGCACCTCCGGCACCATGCT