Description :
From Genome Similarity Track
Location :
contig_8:474135- 475663
Transcript NameFunction/comments
g1635.t1hypothetical protein

Sequence
1528 bases(100 bases per row)
CAACACACTCTAGCTCACATTAAGTTGCGCGTTTAATAGTAAGTGGCCACCTTTGGATGCTTTAGGGACCCACAGTACCAATGAGCCACCTCCGGTACCA
GGAATACCAATAGCATCGTCGCGCCAGCGGTCCAAATACAACGTTTTACCGCCCAGCGCGGTGGTATTTGAAGTCCACGTCGCAGTTCCGCCCGCGGAAA
CAGGAACTTGGGCAATCTCCTCTCCTCCAGAGTGGATATTTACTTTTACATCTTTTTTGTCGCTGCTGGAGAAGTTAATAATGACTGCACCGTTGCCCAC
CCGTTTCCAGAGCTGGTGCTGCCGTTGAACGCATCCTCAATGGTGTTCAAGCCCAGCGTGGCAGCTTCCGTGCCGTCGTCAATCTCTCCCATGAACTGGG
TGGGGCCGCAGATAGTCTGGACGTACGCTCCGAGAAGCGTCGAAATGTCCAAGTCGTCAAACCCGCTGGTGGAGAGCACATTGAGACCAATTTGAAGCGC
TTTGTAAGTGTAGTGCTGCGCCTTCAGAGTGGTGCCATTGTTGCTCGTTCCCTTTGAGATGAGGTCGTTGATGATGACTCCGAACGTTTTCCGCAGCGTT
TCACGAGACTTGTACGCTGTCACCTCGGTTGATTGTTCAATCATCAGCGGCATGCAGTTGTTGGTCACCATCGCAACGTCGTACCGAACGAGGTCCGAGT
TGCTGATCTTCAGACGAACGTCGGCGTCGCTGATATCGGGGTCCTCTTGCCTGTACTGCTCTACAGTCATCCACGTGCGATCCAGCAAGGACTTCAGATC
AGCCCCGCACGTCGAGTTGGACTTCATACCTGTCTCGAGGGACGAGATGTCACTCGAGTTGAGTCCATCGGCGCCTCGGTAAAGTTGGCACCTTTCAGGA
AGGCCTTGAAATGGTCCCAACTCGAAATGATCTCGTCGCCGTTGGCCAGAATCTGCGAAAGAATGTACTGCGAAGTCGCGAGAACGTATTTCGACGTGAG
CAGGTTTCCCGGGACAGTCCACCCTAAGCAGTTCGTGATGGCAATGGGTATGTCCGTCACAACATTGTTCGTCTGGTACAGGATCGCGAGTAGCTGGGCT
TGAGAAGTCTGTGGGTCAGAAGTCTTGATGTTTCGAACATATCGAACGAGTGCTCTGATCACAGTCATCATCGAGTTGGCACACTTGACAGCCCGTTTAA
TGCCCTTCCCGATGTCCTCCAGTTTTCCGAAGATGCCCATAGAGGCGGCATCCAGAGCCGTCACGGCGATAACGCTGACCTTGTTGAAGATCTCCAGCTT
GCAGTCGTCATTCTGGCGGATGCATTCCATGCCGCACTCGACGGGGTAACCGATCGGGCACTGCGTCCAGCAAGTATCGGTGCGTCGTTGCGGTTGTAGT
CCGTCGGGCACGTCAGCATGATGTGGGCTTCGCGGTAGCACGCAGCATCCGATGAAATGCTCCACGGCCCCACCCAGTTGCGGTAAGTTGAGGTGACTGT
ATTTATCGCCGTGGCAGGAGTAGCGATC