Description :
From Genome Similarity Track
Location :
Scaffold_1:4741- 6095
Sequence
1354 bases(100 bases per row)
gagtcgtaatccgccggatgaagatccatccgtgaaagcggaagggccttcacccaaaatcaccacccttaccccgcgcccctcgtcgaagtagccgaag
aaggcgacgccgaagaccgcgaagatgaagatgatggcacccgacgcggacgagagtgatgataccaagatgtggacggaagacgagcctctactggaag
aaactccaggcgggatttcggctgcatttcgcgtggataaaatggctggcggtcataatacatggaacccaaaataaatgtacggcttttaaaactcgga
tacattggaggttaagatttggatttttatttgaacggcctcgtttaaacttatcgattctacttgtggaatgactataatatataatgtcgtggaagct
gtctggacctcgttgcggttgacctcacagatgttcaatttccatatttaacccttctaagacgatattctgtacaatacagaataagttagatggcagg
atatattatcaattgagcatgtcattaacccaatccaccgcatactacttttgtatagcgagtttatcattgaagatctatgcagggaagatagtcgggg
acttctcaaaatgtatttttgaaaaacaatataaaatttatggaggttgaatattctgtgatgagtcttctaattcgcagaccaccacacgttgccctcg
ccccacacaattcgttctctccacaatgaacggaccatacgagaagacgctcaagcagctacgaagcgagctttccaataaggactggaaggcgagtaaa
ccaaaggggttaagggtggactttacctatcacaggcgtccgcgagctggtacaagatggaagaagattctggagatcgtccttcaaggaatgatccaag
gtcactgtgatcttgaccttctcctcgattcgtttctcatgcacacgaaagacggcacttggtaccctggtcttggagcccgtgtggctcctacttacct
ggacgctctcacgcttactgatgcttccggtaagttccggttcacagtagcttccagcgatgacggtagtgatctgaactaggtcgggtaggacaattct
ctttgatagtggtcttcgagtgtcctccttatatatatgtagggagccctttgggctccatcgtcggggacggccccttcatttcacgacactgtttttc
tacaaatacccacccatctggtatgtgacgttcccacatacctttctttccacattctccctctcgcagcatcccactactgcgaagggtttccttcatc
ttcctcgcgcgactgcatcgcattaaagcgattgcggttcaccctcttcctctc