Description :
From Genome Similarity Track
Location :
contig_43:474049- 475797
Transcript NameFunction/comments
g6414.t1rRNA methyltransferase, putative

Sequence
1748 bases(100 bases per row)
GCTCTGGTTGTTCTCGGAGAGAGTGATGTCATGTTGGCTACTGTTGTTTAGCTCAATCATTACGAGTTTTAAGAAGATGGCTTCCTGCATGCAGTGGCAT
AGTGCGATGTATTCTGCTTCTGTTGTGGATAACACGACTATGTAGTGTTTCCTAGATTGCTATGAGGAAATCTCATCGTAAGTCAATTCCATGTTTTTGA
AGGAATCTTGGCGAGCTTTGTAGCGATCTATTGTGCCATCGCCTTTGTATTTGACGACGAATACCCACCTACATTGCAATGCACGTCTGTCACTGTAAAC
AATGTGATTATCTGTCGTATCCAAGAGCCTGTAGTCCTTCTTGTTGGATGGAATTCCCAGACACATGTATTTTCTAGCCCGTTTTGAGTTTGTTGCGATA
TAACTCCGGGGTGTGAGCGTATGTCATGCAGCCAATCACTTTAATGTAATGTGCTGATGGTTTCTTTTTTTCATGGGGAGTAACTTTGTTTGTGACCGAG
CTCGGGGTGATGTTGAAGAGATTAGCGGCGTGTGTGATGCATTCATCCCAAAGGAGTTGGGCAAGATCTCTGCCGATCAGAAATGCTCGGGTTCTTCAAG
AAGTGTGCGCATACGCCTCTCTGTCACGCCCTCCAGTTGTGATGTGTACGCATTAGTGAACTGTGCGTGTGTGTTATATTTTCGAAGATGATTCTCTCAA
GGTTTTCATATTCACGAGCGTTATCACTTTGGAGTTCCGGATTTCTTCATCGTGCATATAAGCAAGTGGTCCACATCAACGCGAAACATGTTCTGTACTT
TCTTTCTGAAATCCTCGTAGCAGACGTACAAGTCTGACTTGCGCCTGATAGTGTAGATAAACATATAGCGCGAGTAGTCATCAATAAAGATCAAGACATA
TTGACATCCTGATAGTATTGAAACAGGAAGAGGCCCAGCCATATCTGTGTCAACCTTTTCAAGAGGGAGTTTGCCCTTTAAACGGGATATTTATTGAATG
CGTTACGATGTGCATTAGCGTATGCGCATGAGGAGCAAAAGTAGTCTGTGCTTGGATCGAATTTCGACATCCCCATGTCTGTGACGACCTTTGCTAGTTC
CTGCATAGTGCGAAAGTTAGGATAGCCCATTCGTTTGTGCCAGAGTAAAATATTATCGGACGTACCAGATTTGGCCATATGGGCTGCATGGTCGGTGTTT
ACCGGGCGAGCTTCGAATTGGTAGAGGCGAGTGCCATTGCCAGTCTCGGTTTCGAACTTGGTTCCACGGTCCACATTTCTTGGCGTCGGGAAGTTGATCT
TGTAGTCCGTTTCGACAGCTTGACGAACGGAGGGTGGGTAAAACTTGAGGTCAGATGCGTACAGCACGTTGGCTAGGGTAATGACTCGGTCTCTTCCCTT
CTTATATTTGATGGTTAGCTTCACGTCGCCTGTTCCTGCAATGGGAATCTGGTGATTGCCCCCCCCCCACCGTGATGGACTTGCCCACGGTCGGTTTTAG
GGTCGCAAACCATTCCCTGTTGGACGTGAAATGGCGAGTGCAGCCAGAAACGATCATCCATGATGGATTATGGTGTGCGACATGTGCAGTGAGGTTCTTG
GTTGCGCCGACCGTGAAAGTCGTTTTGGATTCTTGGTTGTTCGGCTGTGATTTCCACGGTGATCTTGGCGTTTTCCATTGGGAGAACGATTGTTGTTTGT
TTGACCATGGTAGTTGGTCCATGAGTAGTTTGCCATTTTTTCCTTGTA