Description :
From Genome Similarity Track
Location :
Scaffold_696:474- 2843
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_696-fgenesh-gene-0.0Gene of unknown function
Pytve_DAOMBR484maker-pve_contig_696-snap-gene-0.7Protein tyrosine phosphatase type IVA protein 1

Sequence
2369 bases(100 bases per row)
ACGCGTTTGTGCGCAAAGCCGAGCACCGCGCGGCGCTGGTGGAGGATCTCGCGAGCTTCTGCCGCGCCAACGAGCTGCAGTTCCTCGGCGTCATGGCCAT
CTTCGAGAACGCGGACGGCGCGCGCCGCCGGCAGCTGCTGCTGTTCCAGGACGGCGACGACCAGCGGCTCATCGAGCACTGCGCCGCATTCTTGGAGAGC
GAGAAGTCGCTGCGGCTCGAGGCGGTGGAGTTGCCGTTGTTGCACCACGACCAGCAGCGGCTGCTGGCCTTCGAGCAGCTCAACACTGGCGCGTCGCGCA
AGCAGGTCGTGCCGCTCGTGCAGCAGGCGCTGGCCAAGCTGTGAAGGCGACGGTGATGACGAAGGCGACGTGGACGAAGGCGACGCGACGGCTATGGTGA
CGATGAAGGCGACGCGGAGGGAAGGAAGGCGGCGTAGCTAGGGAACGTGTCGTCAATATGTTTCTGTCGATTCTATGGGGCGCGGCCTCGCCGGCCTGGC
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCAAGAGCAGCGGGAAAACACAGCAAAGAGACGCGCTGCCGACGGGAACAGCAGCA
CGAGCAGGAGACGGAGCCGCGGCCAGCCGACCGGCCGGGCGGCAGACTGGCGCGCGAGTCACATGATGGAGCACTTGGCCTTGTGGCCGCGGCGCGGCTG
GTACTTCTCCAGGTACTTGAGCTGGCGCAGGTTGATGGCGCCGCGCCGGAACTTGCGGATGTGCTCCACGGCGTTGATCGGGTCCACGCCGTACTCGATC
AGCGCGATCGCCACCAGCACCGGCGCGCTGTCAATGTAGGCAAATAGCAACACACGTCACAGCGTCAGGTCAGTATCAGTCGCTGTAGCCATCCGTCACA
AAAGCGGGGGAGGAGAAAGTCACACGCACCGTCCGAGGCCAGCGACGCAGTGCACAGCGATCGACTTGTTATTCCGCGCGCCGCTCTCGTTGTCCTTGAA
GCACGTCTCGACGAGGTCAAGCCAGCGGTCGAGGATGTCGGCGTCGGGCGACTCGCCGTCCGGGAACTCGAGCTCGTGCACGCGGATGCCCGCCTGCTCG
ACGGCCGCGCGGTCGTACGTGACCTCGCAGGCGCGCACCAGGTCCGTGGCGTTGTACCGCTTCAGCTCCTTTAGATACGTCTGCAGGTTGCTGTCGGTCG
GTGCGTCCATGACCACGAACGACAGGTGCTCCCACGCCACGAGCGTCGGCTTGTTGGTCGGTGCGATCATCACTCCCGAGCCTCTGGTCTCTTTTCCGTA
ATTGCTTGCAACGTCGTCCACCCCTCGGGCTTCCCTCGCGGCCGAAAGCGGAGCGAGTGCGGCCGCGCGGCGGCTTATCCCATCCGTCGCGTGCCGAGCG
CGTGCGTCGAGCTGGGCCGCGGCTCGGGGCGTGCGGTTCGGCCGCTCACGAGATGACGCGGCGGCGCAGCTTGCTCAGCGCCAGCAGGTAGAGGGGCGAG
GCTCGGCGCTGCCCCAGCACCCAGCGCAGTCGGACGCGGCGGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCTGCGGGCCGCCGA
CGGCGGGGGGCGACGCGGTCCGAGGCGCGGGGGAGGCACGAGGCGCGTCCGAGAATAGCGGACGCTCACCTGGACGAAGCCTGCGGGCGTCGGAGATCGC
AGGGAGAGCGAGGGGATATGCGGCGAGACGCGCGCGACGCTGGAAGGCGGGCGGGCGGTCAAGCGGCTTGGGCTATTCCTGCGGGGCGAGTTGGGGTGTG
GGGCCGCTGCAGAGGGTGGCTGGCGTAAATTGGGGATGCCGCGCGGTATTTTGGGGCCGTAAATTACTTGCGCCAGCTGCTCGTGGCTGGCCGGAGCGCG
GTGCCGAGCGCGTAGTTTACGGCCAGAGAACAACCCACGCGAAGATAAAGCGCACTGGCAGGTGCGAGCGAGCCAGCGGCCGCGACCTGTCCCATAGCCC
CGCGCCGAAGTTTACGCGACACCCGGCCGAAAACTACCACCCGCTGACTGTTTTAGCTTTCCCCGGAAGAAAACAGAACCTCGCTCGAGGCAAAGCAGCG
TAGCGAGCCGGCGACCAGCCGACCGTTGGGTCGACTATCTGGCCAATCAGCGGCCGGAACGGAGTCGAACGGCCAATCACCGCGACAGGCAGCCGGATAT
GAGAACTGACTCGCACCGCCGCGACTTGGCGTGAGTGCTGGTGCCATGGCTACCAAACGACCGCCATCGCACGCCAAAATGCAGTCCGCTGCTACACTGC
GACAGCCTTTTGATCCTACACCACGAGGAAGATTCACACGTGAGCTAGCGGTCGAGGCGGAGCGTCGCT