Description :
From Genome Similarity Track
Location :
Scaffold_883:474- 2008
Transcript NameFunction/comments
Phyta_totarag11176hypothetical protein

Sequence
1534 bases(100 bases per row)
GGGCTAAAAGTCTCGGTGTAGTCGTAACCGCAGCGTTGGCTAAAACCCGTAGAAACAACGCGGGCCTTGTACTTGTCCAGACTTCTCATCTGCATGCACA
CTCTTCTTGGACACCCATTTCGACTTGATAGCCGAGCGACCTGGTGGTAACAGAACGTCGACAAATGTTTCATTGTGAAGATGACTTTGAAACTCGTTGT
TCATGGCGTTCTCCCACTCGCTTCAATGTTCTGACCGTTACACTTCATCAAGGTTGATCGGCTCCACACCGAGTGCCCAGTTTTCGATATTTCTAGGCGT
CAATTACTGATAGTAAAATCTATCACACCCATTTGTGCCATCAAACCGCGCTGGTGCCATCCGATCTTCAATCATGTTGCAGACGTCCTCCAGTAAGAGA
TGAGACTCCTCGAAGTTCAGGCGCCGCTAACTGGCCTTGGGGGTTCTATTTGATCGTCGCGGAGGGGGAACAGCCTTCTCCCGACGCGGGTCACCTCGCA
GCCGAGCTTACAGCCGTGCCACTCCCACCAGTTCTGACGTTGTCGACGTgatcagttgctgctgcggcttctCACAGTCGGCAGGTCCCATGGCCACATC
CTCCTTTGCCTCTTCAATGGtctcaagacgaagctgctgccttgTGTGATGCACAAGCTCCAATGGAGAGTATTTCATCTGGGTACTGATCATAACTTCG
TAATCATCTGTTGCAGGTAGGGACTGGTCCTCGTAAAATACAACCGTGCGCGCGGTGCTTGTCTCGTCAGCTCCATTTTCCGGAATGTGCCCCAGGTATG
AACCGCCCGTTGCATAGTAAAAAAATATCCCGTTCCGTGGCTTCGCGTCCAACCTCTTCCGGTGCTCTGTGGGAACCAATGCCTGTACCTTGCAGCCAAA
GTCACGAAGGTTGTCGATGTCCAGTCCTTGCGTAGTAAGCCTCCATAGACGTCTTTCCGTCAAGTAAATTTGTCTGACAGCGATTGCGTACGTACGCCGC
GCACACGACAGCATCTGCTCAATACTTCAACGCCAGGTGAGCTCCAAGTATCCTTGATCTCACAATGACGCGATTGCCGCGCTCAACCTTCCCGTTTTGT
TTAGGACAGCGCGGAGCATTAAATTCATTACGATACCGCGCTTCTTTCAGTAGTCAGCGACCTCACTCCCCATGTATTCCGCGGCATTGTTCGACTTCAA
GAATTGGAACACGATATTCCGGAGAGTATGCTTTCAGCTTTGCGAGATAATCCTCGATCGCGTCAAATTGAGTGTGCGAGTTCTTGTTACGCAGCTGATA
GACCATGTCAAGATGGAAAGACTCAATCACACTGTTCAGCAGCCCAGTGTAGTCATCGCGCGCCGTCACTTGCATCGGTCCGACATAGTCAATGGCAAGC
AGAAGTTGATTCGTTTTCAGCTCATGTTGCATCTTAGCAGGGAAGGGTTTCTGCGTCAGTTTCCCGCGCACACACGTTGGGCACGCCTGCTCCATCACTC
CTCTCCAGGATGGTGTCAGGTCAGCGAGAACTTG