Description :
From Genome Similarity Track
Location :
Scaffold_3271:474- 1698
Transcript NameFunction/comments
Phypl_g15734hypothetical protein PHYSODRAFT_342937

Sequence
1224 bases(100 bases per row)
gacgtggccatggagTCCATAAGTTCCCACTCCGCCTCCAGGCACAAGCGCGGCCATGACGAGGACCCGGACGATCTGTTTGATCTGGACAATGGCACAC
CGGGAGCTGCGGCCGCGATTtcagccacgacggccggcGCGGGTATCTCTCGCGTACGTctctcggccttctcggagTTGAAGGAGTTCCACGGACGAGA
CGCCAGCGAGGAGAAATCCAGAGCATGGCTAAATCGAGTGAAGTCAGCGTCGCGCCGTGACGGTATGACTGGGAGCGAAGTCTGTGCCTCGTTCGGAGAC
CTGATGGCTGGACCCGCCCGCCAATGGTATCTGcagctgaccaagaaggtCCGGAAATCATGGCCGGACTTGATGGATCAATTCTGTGTCCAGTACTGCG
GCAAAGGCGTGTCTATGACGAGTCGCTATTACCATGTGACTAAGCATCCCGATGAAGCTCCCTTGGACTACCTGTACCTGCTTAACGTCGCCGGAATGCG
GGCGAAGATCCACTACTTGGACGGCACCACGGAAGGGAAAAGGGAACATGTGGAGTTATTCATCGCCACCCTGGGTccccaagagcaagagctggCATCG
CGACTCACCTTGATGGAAGTGCCTGACACCCccacgctggagaagaaacTGCGCGCCAGACAACGTGGGCTGTCGCATCAGAAGAAAAAATTATTCGGGT
CGAACAAGTTCAGGCAGAAGGTACCAGCTCCGCCGCGGCCGGCCTGCGCATTGCAAGCGATCCAAGCCACGCCAGACGGGTATAACTCGGGACGTGAGAG
CCAAGCTAGTGACGATTCGATCTGTGACCAAGATCGGGATGACGATGAACGAGCGAGATTGTTCGTAGCAGGTCAGACGCCGCCGGGAGAAATCGTCCGA
CGCGATCTGGGTCAGGAAAACCCGGGACGGGATCGCCCCCGATGCCGCTACTGCGGCTCGCGACGCTATTCCGACGACGATTGTTGGAGTCTCCTGACGT
GCCAGAAATGTAATGGTCACCACCCCCACCGACTGATGTCTGCGGGCTCGCAAAGCTTGCGGAGACGTGCATGAAGCGGGAGAGTGTCCTTTGGAAGAGT
TCTTCAACCAGCTACGACAGTGGTATAACCCGTAGAAACATGCGgggatgctgccgccgacggcCGAAAAGATGTTAAACTAGATCGCTCGCTGGGTTGG
AATCCAGTACGGGACTAGCGATCT