Description :
From Genome Similarity Track
Location :
Scaffold_23:473942- 475986
Sequence
2044 bases(100 bases per row)
AGCTCCCACCAGATCGAGGCGTACGGCATGAGATCGATCTCGTGCCTGGCACAAAGTACTGTGTCACGAGACAATGGCCTCTTCCACGCGAACAGTGCGA
GGTCATTGATGCCTTCTTCGCTGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTTGAAGTCCCCGCCCTCGACGCCAACTTTCTGCGTTCGGAAGCCGAAC
GGAAAGTGGCATCTAGTTCATGCTTATAACAAGCTGAACAACGCGACGGTGCCGGTCCAAACACCAATCCCGCGAAAGGATGTGCTGTTGAACAACATGG
CCGGTAGCGTACTTTTCAGTGCGCTGGATTTGGTAGACGGATACTACCAGATCCTGATGCGAGAGAGTGACATCCCGCTCACCGCGGTGAGCACTCCAAG
CGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGTGACGTTCAACCACCTGGTGACGCAATTGTTCCGCCCTTTGCGTACC
TTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGAAGGCAAGACGGCCATGGAGGTGCATCTGGGGTACCCCCGTCGAGTGCTGG
ACGTAATGCGAGCGAACAAGTTCTACGCCAACATCGACAAGTGCGTCTTCGCGTCACCAGAGATTAAGGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGT
TCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCAACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGGTTGGGCTTGGCCAACTACCTTCA
CAAGTACAGTGCAGGGTACACGGGCTTTCGCTGAGACCTTGTCGGGCCTCCTTAAGAAGGGCGTCGACTGACGCTGGGAGCAGGAGCACCAGGATGCCTT
TGACAGAATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGACCCTACCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGACTGTGTCATC
GGTTGTGCACTGCTGCAGGCCGACACGGCTGGACATGTACGAGTTATATCGTTCCAGTCCAGGCAGCTCAAATCCGCCGAACAGAACTACCCTGTCCACG
ACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTTCGTGTTCACCTTCTGGGCTCCCGGCCCTTTGTGATCTACACAGACCACACGTCCTTGAG
GACGGCGACTAACTCGCCTCACCTCTCCCCAAAAGATGGGGACGTGGCTGTCCTACTTCGCGGAGTACAACTTCCGCGTCGAATACAAGCCGGGCAAGCT
CAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCAGACTACGAGTTGGCCCCACATCACACGGGTGACAGCGGATCTATATGATCGGATACGCATGGCGTA
TCGGGACGATGAGGCTGTCGCACCTATCGTCAAGTTCTTCACGGCAGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCCACAGCGCTCACGGCTCCAC
CGATATGAGTTGAAGGATGGCCTCCTCTATTACCGTGTGGGGCCCAATGAACCTCCACGGGTGGTCGTACCCAACGACAAGGATCTGAAGTTCGACATCC
TCGTGGAGGCGCACGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACGTTTCTGTCGGTATCTCAGGCCTTCTGGTGGACCCACATGTACAAGTG
GGTCGCCCATACATGAAGACATATGAAACATGTCAGCGGGTTTAACCCGCAAGGCACGCTTCGGCTCCACTACAGAGCCTGCTCGTACCGGCTGACTGTT
GGAAGTTGATGAGTCTTGACTTCATCTTTGGGCTTCCCACCGACGGACACGGAAACACCAGAATTTTTGTGTTCGTGTGTCGGCTGAGCAAGATGGGACA
TCTTGTTCCGGTCCCCGTCACTGTTACGGGCGAACAAACCGCAAGGTTTTTCGTCGATGGCGTGCTCCGCTATCACGGTCTCCCGAGACGATTGTCCCGG
ACCGAGACCCGCGGTTCACGGCTGCGTTTTGGAAAACGCTGTTT