Description :
From Genome Similarity Track
Location :
Scaffold_2:47393- 58814
Transcript NameFunction/comments
Phyci_75798replication factor C subunit 4
Phyci_207190WD domain-containing protein, putative
Phyci_88952Hypothetical protein
Phyci_88953conserved hypothetical protein
Phyci_88954small GTP-binding protein
Phyci_75804PREDICTED: autophagy-related protein 8f-like isoform X2
Phyci_262821conserved hypothetical protein

Sequence
11421 bases(100 bases per row)
AAAGTGGCGCGAAGCAAGCACTTGTGAACGTTTGGATCAATTGCTCATGTTCAGCACCACCTCAACCTCGAAGACCAACGTGCCGGCGCCTGTGCTGCCC
TGGGTGGAGAAGTAGTAAGTGCGTCGTGTTAATCTGCATCTGTATCTCATTATGCAGACGTATTTGACGACTTCATCGTTGCGGTTGCTGCGCTCCAGCC
GTCCCAAGAACGTGGACGAGATTTCGCACCAGGAGCACGTGGTGGCCACGCTCAAGACGTCCATCGCCAACGGCCAGCTGCCCCACTTGCTGTTCTATGG
ACCCCCGGGCACGGGCAAGACGTCCACCATTGTGGCGGTGGGGCGCCAGCTCTTCGGCCCGGACTTCCGCAAGAACGGCCGCTTCTTGGAGCTGAACGCG
TCGGACGACCGAGGCATCAAGGTGGTGCGCGAGAAGGTCAAGAGCTTCGCCCAGGGTGCCATCAGCAGCGCCAGCGGCCTTCCGCCCTTCAAGATCATTG
TGCTGGATGAGGCCGACTCCATGACGGGCGACGCGCAGTCGGCGCTGCGTCGCATGATGGAGAACTACTCCAAGGTAACGCGCTTCTGCCTCATCTGTAA
CTACGTGAGCCGCATCATCGAGCCTGTGGCCTCCCGATGCGCCAAATTTCGTTTCGCGCCGTTGGAGAGAGGCTCGATGGCGTCCCGCGTGCGCTTCATT
GCTTCCGAAGAGCATGTGAATGTGCCGGAGCCGGTCCTGGAGTCGCTGCTTGAGTGCTCGAACGGCGACTTGCGTAAGGCCATTAACTACCTGCAGAGCG
CCAAGCAGCTTTGTGGAGACGACGAGCTGTCCCAGGATGATGTCATTGCTGTGGCCGGCCTTGCTCCGCCCGAGCTTCTGAAGCAATTCTGGCTGTCGGT
GGCATCGAACAGCTTCGAAAAGATGAAGACGGACATTGAGAGCATCCTGCTGGCTGGATACCCGGTGCTCACGATTTTGCGACAGTTGAATGACGATGTG
CTTGCGCTGGAGAAGCTCAGCGACGTGCAGAAGGCGAAGATCAGTCTGCGCATTGCCGAGGCCGATAAGAGGCTCGTGGATGGCGCCAGTGAACACTTTC
AGTTGCTAGACGTTGCGTCCTTCGCCATGCGCATTTACCACTCGGCATAATACATGTGTATGAGCTTGGTATGAGAATGATACAGGCGTAAATAAAGCGG
AGCGGTGATGAATGAACACATACACAGTCGAGTTTTTAGTACGAACGGCATGGCCGTCAGCAATAAGGACGCTGTTACCAGTAACGAATGTCACCTGCTT
GCCGAGTATCTAGTTGCTCGCAACGGTAGCTGCTCCTTGATCATTAACCGAAGACATCTGCGTCCATTCGTGATTGCTCTGTTGCTTCCAGAAGGTAACC
TCGTCGTCGCCAGCGGCAACACTGAGGACCGAGCCAGTGAGCGACCAACTTATCCGGTACACTGGCGCGCGGAACGTGTGCACCACGTGGAGCTCCCACT
CGCCATCGGCCTCATCTTGAGTCCAAACACGAACTGTGTGGTCATCTGAACCAGAGGCAATGACGTTTGCAGGGATACCCACGTTCGGCGCCCAAGCCAC
GTCACGAACCCAGTCATTGTGTCCGTACAAGGGGGTGTTCACGATTTCCCAGTAGCTGTTGCCACGGTTTCCACCTTCCTGCGGGGCAGTCACAAACTGC
CAGATAGTAACCGCGTGGTTGCACGATCCAGTGACGACGCGCTGAATCGGTCCTTGGGCTCCCTGCGACCCCAGCGAGTTGTACGGGGCCCAGCTCACGG
ACGTGCAGCCCATGCCCTCGTCCGAGTTACGGAAGCTAGACGACACCACCCACCCTTCCCGCATACGCGTAAGGAACGACACCTGGCCGTCAGCCGATGC
GCTGGCCAGGCACAATCCGTACTCGTACGGCGCCCAGGCCACGCTCAGCACCGCCAGCGAGTGGAATTCGTGCACGTGCTTGAGACGCCACTCGGTCACG
TTGCCGACTCCCCCGGCCCCCTGCTGCACCAACTCCTCCCGGTAGATATACACCTTGCCGTCCTGTGCAGCCAGGGCCAGCACCGCGCCGAACTTCGGGT
GGGCCCAAGCCACGCGGTGGATGGGGGCCGCCGAGTCGTCGGCCAGAGGCACCACGTGCTGCAGGACGTGGAGTTGCTGCTCCTGGGGAGGGTCCTGACC
GCCCTTGGACGCCGAGTTGTCGTCTCCGTCCCCGCCCGCCACCATGGCCTTGGACACGTCGTACACGCGGAACGTCCTGTCGGACGAGCACGTGACCAGG
CGCTTGCCGTAATAGTCCAGCTGGATGTCGTAGATCATGTCATTGTGCTCCGTGTCGATGCTCGCCACGGGCGTCTGGCGCTGCTGCTGCTGCTGGGGGT
GAGGATGGCCGTACGGCGCAGCGAACTGCCCGCTCGCCGCGGAGCCGTGCGCGAACTCCATCTTCCTCTTTGTTGATGTGGCCAAGAAATGTGACGGATA
CCTTGCGCGCAATCGGGACTATTTCACAGATTTTGTGACCAGGTCTATAATTGACTTATCACCAGTTCCAAAGGCAACTTCTGTGCGCGATGTTTGCTGT
GAACGGGCCGAGCGGGCCGACGTCGCGCCACGAGCGGCGGGTGAAGAGCGACCGGCAGCGAGAGGAAGAGGAGGACACCCGCAGGCGCTGGGCGGAGAAA
AAACGCGAGCAGTTTTTCAGGGAGAAGCGTGCGCAGTCTGGTGAGCCTGGCAAACCTGGTCAGTGAAGAGTGGACTGGGGCTTTGTAGCGACAAGTGCAA
CTTGTGCACTCACAAGTTCTGTGCGCGGCAGCACCAGACAAAAGCAAAGCAACGGAGCGCCTCGTCGAGTCCGACATATTCCAGGTGCGTATGCAACGAA
AATGCTATTGCGGTGGCGAGTCTCTGATCGCCTTTTCTGATCTATTTATTGGTCGTTCGTCTACAGGGATGCCGGATTGTGTTTAATGGACGCACAGGCA
AAGTGTCCTCGTAAGTGTGCGAGAGCTATAAAGTTAAAAGTGTTAGAGAGGTAGTAGAAGAGTTAAGCAGGATACGTTGACGCTGGATTATGCGTGGTGC
AGATACTACTTAGCCAAGTTAGTGCAGGAGCATGGTGGCAACGTTGCGTACGTCCCCTGTTGAGCTCAAGTCGAAGTTGAAGAAGATACTACGTGAGCTA
TCACACAAACTGACCTTTCCTGTGTTGGTGGCTAATCCATCAGTTCCATGCTCACTGCCACGCGTGTCACGCATATGGTCGGTTGCAACTTGAATGGGTC
CAAGGCCGACAAGGTGATCAAGGTAATAACGCGGTGCTTGAATCAAGCACTCGAAGCGTGGCGCTGAACGAATGAACTGTGTTTCTTGTGGCAGCGCTCC
GGCAAGGTCAAGTTTGTTAGTCCAGGTTAGTTCTTGCTCCTGCCCAATGGTGGTGTTTCAAAACACTGACAACTGCGCCCTTCCTTTTTGCGGCGTAGAA
TGGATCTTGAAGTCCGTCAAGCTAAAGAAACGCCAGCCAGAACACGAATACCTGGTGTACAAAGATTCTCCTGGAGCTGGTTCGCTACAGGCTGCATTCT
CGCGAACAGCGCCAGCAAAAAAGTGAGACCCGAACGCACCATCAGTAGCAGATTCGAGCACACAGAGCGAAGACGCAACGCAAAGCCGAAACACCCCTTG
TAAAAAGAGAAAGAATATACCATGTATAGGGTCACAACTAACCAGAGTAGCATTCGTTGTCGTTCCTTTCAGCCAAAACCGAGAACGTGAAAGCATTAGG
AGCGAAGCGCAGAGCTGACCTGAATTAGCGCAGCCAGTCACCCGTTCCCAAGTACTATCGAATCCTCGAACAGCCTTTTCACCTGCGCCGCACATATTGA
TCTTAAACCTGTCCTGGACTCGTGAGTGCTGCGAGCACCAACTGAGCCCATTTCTCGAGCCTCACCGCCCAAGACTCCAAAGCTAAACTGCAGACAAATC
AACTAGCGCGCGACGCGAGGCGAACAGGACTAAACGACACCGCTTAGCAGCACTTCGACCCGCCGTTGGACGGAACCTGCTGGCCGGGCGTCAGCTTGAC
GCCAGCCTTGGGGGCCACGGGGGCGTTGGCCATGCGCTTCTTGATCTGAGCAGCCATCATCATGAAGGCCTTTTCGACGTTGGCGGCGTTCTTCGCACTG
GTCTCCAGGAACTCGATGCCCAGGCTCTCGGCGAACTCCTTGGCGGCGTCCGTGCTCACGACACGCTTGGCCGTCAGATCGCTCTTGTTACCGACAAGCA
GCTTGTTCACGTTCTCGCAGGCGTATCTGCAAATCATAGCCGCACAATAGTTAGCACTATTCCGCGGGTTTTCTCTACATAACCATCCTATAATATCGGA
CGTACCTATCGATCTCATGCAGCCACTGCTTCACGTTGTTGAACGACTCCTGGTCCGTGACGTCGTACACCACGATAATACCGTGGGCACCGCGGTAGTA
GCTGCTAGTGATCGTGCGGAAACGCTCCTGGCCGGCCGTGTCCCACTACAGCAGCACCATATATTTGTTCAGTCAGCTCCACGAACAGCTTCCAACAGGC
GAATAGGACCGCGAAGGACGTACAATCTGGAGCTTGATGGTCTTGCCGTCCAGCTCGATCGTGCGAATTTTCTGGACACAGCACAGAAACAACAACGACG
TTAGCGTCTGTTGAATGGGGCAGACAGGGGCCGTCCTTGTCTCGGCACTCACAAAGTCCACGCCAATGGTCGAGATGTAGCTCTCCGTATACGTGTCGTC
GGCGAAACGCAGCAGCAGACACGACTTGCCGACGCCAGAGTCACCGATCAGCAGCAGCTTGAACAGGTAGTCACTGTCGCAGAAGAGAGGAAGAGGGAGG
CACTGATCAGTCCCATGCTGGCCTCTCAAAAACAATAAATCCCTGGGCAACACGTACTATTCCGGGTTCATGGTGGACGATTCTGGGGAGAAAGCGGCGG
GTGACGGCGCTTAAATCTGCAGCACGGCACAGTGAGATCCAGTCAGTCAGTTAGGCTCCTACTTGTGACTGCAGCGCCCCTCGTCCGCCCTCCTCCGACA
GAAGAACACGGGAGGGAAGAAAAGATCGAGGATCCGCCCGCCCACTTCGACCAGACGGCGCGGGGGAGAGTGGCCTCGCGACAGAGGGGGAGGACGCGGG
GGGAGAGCACAGCGCTGCGGCTGGCGCGCAACGGACACCTACACAGAGGGCGAGAGGAGGCGACGCGCGCGTTCCGAGCGTTCTTGGGTTGTGTGCCGCG
AGTGGGTGCGGGGTGCGCGTCGAGTCTGCGTTTGGTTTCCCGAAGAATGCGGAGAAAGAACGGGGGCCAGGGTCCCTGGCCGTTTTCCCCGAGGTTTTAC
TGCACCCCGCTCGAGGTTTTTCACTCATTTCAGCCAATGGTGCGGCGTTCGCGCATTTATGCCCAATCACAGACCTCCCATTTGGGCCAATCACAGACCC
CAGCGTGGCGCAGGGAACTCATTCTCGCCTGAATGGACTTGGCTTGATATCGCCAAATGGCACGCTCGACGTTGAAGGCGACATGCCGCCACTGCTGGTG
CTAGCTAGTGCTGCTGCTGGCGCAGCACGGCAATCCCGGGACCGAGAGCAGCCAATGGAGCCGCGCCAGCGTGGCTGCCAACGTCCGACGTCGGTTGCAC
CGCGATTGCCATCGGCTAAATATACGCCCCGAAAACCGAAACGTGGCTTGATGGCGCTGATGCAACTCAAAAGCGACGGTGCTTGCTGGTAACCGTGGCG
AAGAAGGCTGCCGCTGCTGCCAGCCATCTGTCGGTGGGGCTCCGCCGACTGCTGCGCGGTGAGCAGCGGCGCCTTGTGCGCGGGATCGTATGCGAAATGT
CGGACAGATCCCGCTCGTGGCTCTCGTCCAGCGGCGATCGCAGCGGCACCTGGGCGTTGCTATTAGCGAGCACCTCCACAGCTTCTTCCCCCTCGCTAAT
GTCGCCGCCGAAGACCTGCATCTATCTTGATCTTCAAAGAAGACTTTTTCACGGCGTCATCGCTGTAATGACCCAGATGTAATAGACCCCAGATGCAATA
AACCAGCCCTACCTGCAAACCTGGAGCAAGAGGAAGAACGTCTTCTTTTTCCCTCGTGGTCTAACGACTGCATTGACCCTGTAGCGGAGCGCTCGCCTGG
CCAGCTAACCTTCTTCGCTCTGGCGGCGTCATGCTTGCATCGCATGCTGGTCCGCTCGCGATCGCATATTCGACTGATTTCCGAGATTCATTTTGGTTCA
ACCTGAGCGATGATCTCGTCCTCGGATTTTTAGCGCTCGTGTGGCGGCAATTACGCGTCGTTCTCGAAGACCTTATCCATACTCCGACCAGCACAGCTGC
TGATCCGGGCGGTGCAAAAGGCCGAATTAGGGTCTCTATTAAGCGTCGGATTAGGATTCCTATCCGCTAGGGCTGTGGGTCCGGGCAGCGTTTTGTTCCG
CCTTCAAGCTCCCCCCACACAAAGAAAGTGGGGAAGCCGAGAAGAAACGTCGAAGGCAAGTGACCAGATTGAggcgcggccggcggcggcgccAGCGCAC
TCATGCTGCGCCGCCGCGGGCCCGTCCTGCATGTGCTCGAGCGCGTGCGTACGGTGGCTGACCAGCAGCAGCGCGTGTCCGTTAAGCCGCGCTATGGGGC
GAGAGGGAGCGCGCGTTGCGCTCGCGGGCTCAACCCGCCTCTGGTTCGCGCCTGCACCCGCTCGCCTGCGGATTCCGTGGCTATCGCGGGTGCAGCGTGC
GAATCCGGAGTGCTAATAGTGTGGAGCGACCCTTCGAAGGGAGGGACCGTGTCCTGGGCGGGAAAGAGACTGACGGGAGACGCTGCCGTGTGACTTGTTG
CAGACGTAACTATCTCGGACAAGCGCTAGCACAGAGAAGAACACGCCGCCAGCCTTTTTCGTCGCGACGATGAGCTCGTTCAAGAAGGAACACCCGTTCG
GTGCGTGGCTCTTTGAGCTCCCGAGCGCCCGGGAGGCACCTCGGTCTCAGATATAGGCTGACGACGTTTGATGGTGCCGTGTTTGCAGAGAAGCGCCAGG
CCGAAGCCCAGCGCATCCGATCCAAATACCCGGACCGGATTCCGGTGCGTGTTCGTCTTCAGATCCGCCTGTGGGCGTTGAATGTGGTGCTTTGTGCACT
GACCGGCGGGCTCTTTGGTGGTGCAGGTGATTTGTGAGAAGGCGGACCGAAGCGACATCCCGGACATTGACAAGAAGAAGTACCTGGTGCCGGCCGATCT
GACAGTCGGCCAGTTCGTGTACGTGATCCGAAAGCGCATCAAACTGAGCCCAGAGAAGGCGATCTTCATCTTCATCAACAACGTCCTGCCTCCCACCGGT
ATGCAGCCTCAATTTCGTTTCTTCTTGGTGTCGTTGTCGTTGCTGAATGTCTAACAATCTTTTATTTTATTTTCCGGTACAGCGGCACTGATGTCGAACA
TTTACGAAGAACAGAAAGACGTGGATGGCTTCCTCTACATCACCTACAGCGGCGAAAACACCTTCGGTCAATAGGCGCTGTCGGCGTGTGGGGACTGGAT
TTTGGTTGAAGATTTTTTTTTCGTCGTCGCTGGGGTGGGGGGTTGTGGATTCTGCGCTCTCGAGCTGGGAGCTACAGTATTGTCATTCAGCATCGGGTAT
TCAGACGACTTCAGCAGAAGGGTGATGGCAAGATGAAGTCGGTAAAATGGAGAAGCTGAATCGCCACAGACTCCTACTCCAAGCACGACAAGAAGTATTT
GCTGCTGCGTGTGGTCCATTCTTCTAAAGCTGGCGATGTGGATATTTCCTAGGAACAAAACCCCATAAAAATCCATGCAATTCTATTCACACGCTCGATG
TTTCCGAGTACAGCAGTTGCTCTTTTCACTCACGTTGGAACTGCAGCATTTGCAAACCTTGGCCAACAACGACAACTTCATCAGCCTGAGCAGTTGGGGC
TTGCCGTATCGCGAGATCTGCAATATCGGCGCATTCCGAGAAGGCGGCACCTCGCCACTCCAGCTGAGTGCCGTCCCGGTCGCGGCGAATGGTCCATTTG
CTCACTCGCTGATCGTAGCCTGCAACGAAAACAACCTGTGCGTCCACACAACCAACGGTTTTGATTGCTGAGCCGCTGGCATTCACTGCGCGCGCTTCTG
ATAGTTTCTGGCACGCGGGGAAGCGCAATTCTTGCAGCGACAAGTTCTGGTCATCTCCACCGCTAATAAGAGTGACGTCGAGGCTACCTTGCTCCTCGCT
CTTTGTGCACTTGACAAGATTGATGCAATTCGTGCCCATATCGTGCGCCAAGTAGTTGCCACTTGGCCGCATACAGCCGATGAGCTCAAGAAGTTTCGTA
TTGACCAAGCTGAAGTCCTCCTTCGATTGGAGAAGGGAGCCAATATTCTTCAGCAACGCGCTCAAGTCCCACAGCGTCACTAAACCATCCGTGGATCCGA
CTGCCACCCCAGCAATTTCGTCTTCCTGAAACCCAACGCAGGACAAAATCGGTTTTCTTGAAGTCGATCGGCAGTCACCAAGCTCATGAAGCTTGCCGTG
ATCCATGTCAAGCAGCAGGATTTGGGTAGAGCCCTCGGAGTTACACGCGGTAACAAGCCGATACGCGTCGGACACCGAGGGTATCGCAAAAGTTGCAAGC
CCAAGAATGCGGTGGTCCTGTTCAGCATCAGCCCGCTCCTGGCCGCAAACATGGCGAAGCAAATCGGTTTCTCCACGAACTAGCCACACATTCAACCGTT
GTTTTCCACCTCCCGAAAGTACGATGTGCTCCTCGACATCGTCGTCATTTTTACGCCGAAACACTGTAAGGGCTCGCACAGTAGTCGTATGTGCGATTCC
TGTCGCCACACTGTCCCAGCGCCAGCTCCTGCTTTTGTCTTGGCCACTTCTAACGCGACGGCGATGAAGCATAAGACTATTGTCCTCTGCTGCAGTAACC
AGTCGATCATTTCCGAGGAATGCCACACATGTTGTCATCCGGCCGTGGTGCTGGTCATGCAGTGAGCATCTAGAGAAAATTGGGCAAGGCTCCGACGGTC
TCACAATGTCCAAAAGGGTGGAGTGTACCTTGATGTCTACCTGCTGCTTCTGAGTTGAAGGAGGTGTGAACACAAAGGTATGTGAGGGCAAGGACGAGCC
CTTGCCTTGAGCACTGGTGAAAAGTGCATGCGGACGACGCCATCCACCACACTCGACGTTAAACACTCGATACTGAGCCGAGAAGTTGTGCAGAACTGCA
TGCGCTGCGTGGAAGCCAAACACCATAAGATCACTCTTCGTGTTATCACCGGAAGAAGGTGAGCTCCACCAAAGCTGCTTGATGGTGGAGATACCTCGGA
TGGATTCACGGCCGACCTGCGCAGCTGTCAGCGCCCCGCTGCCATTTTCTTCGAGCGTAAACGAGCAAATATACCCGTCGTGACCACCCGAAAACATCAC
GGTGTGGTGACCTTGGGTGCTGCCAGCTCCGTCAGAAAGCAGGAGTGATGCCACCAGTTCACGCCCATGAACACCTTTAAGCACGAGAGCTGGGCTTCGC
GGCACAGATACATCTTCGCCCTTCTCCGTCGTAGCTAGTGGGCGATGGAAGATATACACGCTACCATGTCCATCTCCCCCAATGATATTTCTCGTTCCGG
ACCGGTTTACCACCAGGATCGATGAGGTCGAGCTCTTCGCAGGGATTTTGAACGTTGCAACAAGCTCCATCTCGATAGATAGCACTGTCGAGTTTTCCTT
CGTCTCGGCAATCGATGGCTTCCACTCGGAGAGAATGCCGCTAGCGCTGCTAACGAAAAGGGCGCCATCCTGCTCCCACCAGATTTTCATCACGCGGACA
TTAGCATGTGCCACCCACGAATGCAACAAATTGCCCGTAGTAGCATCGACGACGCATACGCGGCCCGATACATCACCAAGCAACAAAAATCGTCCAGAGC
CGTCAATTGCAAACGTTGAGAGACCACCAGTTCTAGTTTGTACAGGGGTATCGTCAATTGGTGGAATGGTGAAGAAGAGTTGTGCTGTGAGCGAAGACAG
GTCCAGCAGAAAAATTTCCCCATGTTCTGAGGCAACAAACGCAGTCTTGCCGTTGTTACGAGCACTGAGCACGATGTTTCGCACACTGTGCGATTGGCTC
CCCTTCTTCTTTTTTGTCGCAATCGCAGACGTAGTGAAAGAGACGCGGATGGTTTTACTCCAGTCGCTACTGTCCGGTACATCGGAGGTAGACATGAGCT
GGCGCGTGATATCCCATAGTTTTGCAGCGCCGTCACCACCTCCCGTGGCAATTACCTTCTGCGACGGGTGGACTGCTGCACGCCACACGTGTCTGCCCAT
GTGGCCTTGCAACGTAGCCACGCACCTACCATCGAGATCCCAAAGTTTACAAAGGCCATCCTCACTTGCCGTCACCAAGCCGCGCTCCCAAAAACACACG
TCCCAAATACGTGCCGAGTGACCCCAAGCTCGGAATACTGGCGAGTACTCCTTTGCAAGCAGCTCTGCGCGGTTTGCCGTACGTGGTGCGTGCAATTGCC
CCACTGTAGTTTCCCCGTTGTTCGACCAAAGTTGCACCGTGCGATCGTCGGAGACGGAAGCTAAAGCACGAGCATCCGATGACCAAGCCAGTTTGAATAA
CACGCCATCGTGAGCATGTAGTCGTTGCACTGGTTCCACCGCACAGTCCGAATCTTCGTTCGCATTTTCCATAGGATTCCATAGCAGAATTTGCTGAAAG
ACCGTTCCCGAGGCCACCACAAGTTCGTCCAGTGATCGTCCATGGAATGCCAACGCGTATAAAATACAGCGTTCAGCGCACTGCACGCTGCGCAGAATAT
CGTTGCGCACGGGGTCCCAAATCTGCACCAAGTTGTGCGCGAGGCCCACCGCCGCCAGCAGGGTCTTGTTCGCCTCCTCCGGCGCGAAGTCATCAGTCAG
CTGCTGCACATCGAACACCCAGTCGCAAAACACTTTCGGTTTTCCGAGCACCGTAAGTCCGTCAACCCCTCGCGCAGCTTCCGGGGTCTGCGGCAGATTC
TTGAAGCATGCCACTCGCTTCTGGCCGAAGAATGCGCCGACATACGCCTCCGTCGTGGCACTGCAGGAGTCAGGAAGTCCAACGACATCGCAGCCGTGCA
AAATGCCTCGCGTCAACACTTTGTGCTCTCCCAGGAGCTCGCCGGTAGCGGTGGCGTACAAGAAAACCGTTGGACCCACGCCCACATAGAGTAGAGATCC
ATCGGCAGAGAACGTCACCAGCGTCACGGCGCCAAGGAACTCCTGCTTCTTGATCGGAGGGTACGCCATCACAACCAGTAAATGGCTGTGGTTGAAATAC
GTACCGGTATTTCGCCAGTCG