Description :
From Genome Similarity Track
Location :
Scaffold_209:47392- 50594
Transcript NameFunction/comments
Phyta_totarag5632hypothetical protein
Phyta_totarag5633hypothetical protein

Sequence
3202 bases(100 bases per row)
TCACTTCAAGAACGCGATAAAGCAAGCGGCAGGTATCGTAAAGGAAGGGTTACACACCCGTCCAAGGTACCCAAGGCCCAAATCAACCCTGGTCATTAAG
TCGCGATCTCGCCGAATTAAGACCGATCGCAGACTCGACCACCGAACGGCTCAGCGTCAAGACGTTCCGCCCAGCCGCTacaagttcctgctgtcCATCA
GACAGCCCAAGACCTCAGCACcgagcgtctcctccgagatcacctGAAGAGCGATCTCGCCCTACCGACGGGGGCACAAGATGGGCATGGTTCAATAATC
CccacggatatcggagtaccctCTCCGTTAGGCAGCGGTTCGTGCGCCGTGTGTGTCAAGGACCTGTGCTCTTAACATTTTACAAACCCACTCCACCACA
GTGGTGCGCGTGCTCGGATTTCTGAGTGACTCGGGATTTCACCGTGAGTCACTTGAATTGGAAGCGTAAGCTGAGAATGGACCAGGGAAACAAGCGTCGA
CTGAGATCGGATCACCGATGACGTCGCTAAATCATACTCGATCAGCGGATCGGCGGATTTTTGGGAGGAGCTCTGGCGACGGAACAGAGGAAGGTCTGTA
GACGGGTCTCAAAGAATAAACCCCAACCTCCTCGCAGGCCCCtccagccccccccccccccccccccccgtggGTCTCCACGCGAATCAAGACCCACGGG
ATGAAGGACCACTAGCGAAAACTGGAGGTAATTCGTCTAGCCAACCACCTGGTTCAAGAATGAGTGCCAAAAAGAAGTCTACAAGATCGAAGTCCTCgcg
gaagacgatgaaggcTCCAGACTCCGACATCGAAAATGACGGTAAACTAACGCCAGGAACGATCTATAGGTTTTCCTGATGTAGAATCCAGTGATAAGGA
TCCTTCGCCCGAAAAGCTTCGATGATCTCAAGGGCCCTGTGTCGGAACCGGCCGCTGGATCAAACAAACTGGAAGTAGTGAAGACACTACTCCGATTGTT
CAAGGATTCCGGGGTCGTTGCCGATGCGTTTGAGGCTGACGACTTCTTCGTTGTTAAGCTGGGAGTGGTCGAGCTAGTGCTCCAGGCTTTCTTCACAACG
GTGAAGCAGCTGGTTGGTTGAACTCCTCCCCCCTGCAAGACCGCGAGATCGAAACCAGCACTGGAGATCGCGATATCACAATCAATGCTGACTCCGGCCG
GAACATCGTTGCATACGAGTCAACAACCAAAGAAGTGGAAACGGACAGCACCGACGATCCACCACGAATGACGCTGTGGCCGTTCAGCTCAGTCATGTCG
CGAGATCGATCATTACGCGccgagcaagctgctgacgattCCATCCACGAGACGAAAATCGTAGCAGCAAGACCGACGCGTCACTTGTCTAAGACGCTGA
AGACATACTTCCAAACGGCGATGGGGCGCTTCCTGAAACAGCAAAAGGCACTCCCTAACCTGCTAAGTTCAAGGCAtactggagatcaagataTAGAAAT
GGAGTCGGTTGGATCACCAGACCACAACTCCTCGCCGTGGGAATATGATCCAGATGGTCTTGATCTCGCCGCGCCCGCCTAAGCAGCTatggccacgacg
gcgacttCAGACAAAGCGACAGCTGTCGCTCGCATCTGTGTATCGGCGATGTCTGAGCTGAAGGCGTTCGCCGGGAAATATGCTGGCGAAGATCGAGCTC
GACCTTGGCTTGGCAAGGTGAAATCAGCATTCATCCAAGATCAAGCACCAGATGAAGAGAACTGCTGGGACTTCGGCGATCTTCTCACCGGCCCGGACCA
AAACTAATACCGGCGACTGAGTCGCCCGACGCGCAGCATTTGGAAACACTTGTTCCAGAGTTTTAGAAGCAGTACTCCGGTCGTGGTATCTGCCGCAAGA
CAGTACTACCACGCCAAGAAACGCTCGGACGAGACGACTCTGGAGTACTAGCATCTTATCAACGTGACTGGCCTACGCGCGAGGCTCCAGATCGAAGATG
GATCACCGCATGTCCGCCGTGAGCATGTCGACCACGTTATCGAGACAGTCGATGACCGCGACCTTGCTGATCATCTTGCATTGCTGAGGATAGTCGACGA
TACCTCGGAAGAACTTTGCGATCTCGAAAGGGTGCGAAGGCGTGGCAGACAAAAACAGTCTATGGATCGAGTAAATCTAGATCGAAGACTCCAGGTATAG
CCGCATCCTCTGCCACTCGAGGCGTCCGAGCGATCCACGTGACCGACGACAACAGCGAATCTGAAGCTAAGCTGAGTGGATCAGATGGCGAAGCAGGATT
GCTCAAGGTATACttggcagcggcaggagATCGCGGTGAGCCGCACGATCGAGGACCACCAGATCAAGATCGCGAGCGCCAGAGTTACGCGATTCGTGGT
CGCCGACAATACTGCTACCCTAGATCGGCGGATGGGGTACGCACTGCGGATCGCGCAAGCACACCAACCTTGGGTGCTGGGGACGCTAGACCTGCGAGAG
TGCGGCAAGAAAGGGCATCCGTCTGACCGATGCTTCGTCGTGTGCAAGACGTGCCAGAAAATCCACGATGCCGGCAATACCCGATGGAGAAGTTTTACAC
CTTGATCCTTCAGTGGTTCAACCTCACCAATGCTGTCTGAGACGGTGGAGAAAATGTTAAATTAGGAGGCTCGCTGGTTTTGTACGAGGCAAGCGTTCTA
GATACTGCAGTTATACTTTTGTCGAAAACAAACGGCATCGGCAGTAAGCAAGCTGATGCATCCAATCGACAATACATGTGATCTTCATGGGAAACCTACC
TCCGCTATGTCAAGTCTGCAGAAGATCAACGAATACTCAAGATCGAGAGTGATGGTGGCCTTGGACAGTTCACCGGGAGAATCGCGTGATTACTGGAGGT
ACCACGTGCCCGACAAGAAGTTCAGGCAGGCGAAAGTGGTGGATACCAAAAACGAAAACGCAACCAGACTGTTTGACAGTGGTGCCGAGATGTCCATTTT
CGACACCGCCATTGCTCATAAGGTTGGGTGCTATATAGATGAAAGTCAGACATAGGAATGTGAAGGTGTGGGGAAAGCTCCATATATTGCAGATGGGCGT
ACCAGTCTCAATAACACTCTTGTAGGATCGTTGTTCTACTTCTTCGACGAGTGGGTAGGTCCGCCTACTGACGGTCAAGGCATGAACCTCGGTATGGACT
TC