Description :
From Genome Similarity Track
Location :
scaffold_27:47385- 48582
Transcript NameFunction/comments
Plaha_PHALS_09377reverse transcriptase

Sequence
1197 bases(100 bases per row)
GTGGTCTGCGATGCAAGTGATTATGCCATCGGCTATGCGTTGATGCAAAACGATGATGAGGGCCAAAAGCGAGCTGTTTCgtatcagtcgcgacgaTACC
GGCCTGCGGAACGGACCTATCCAGTttatgacaaagagcttctaGCAATGAGGTATGCTTATCTTACGTTTCGTGTCTACTTGCTTGGAGAGGAGCGCTT
TGCTATCTACCCAGATAATGCCTCACTGCGTACGGCAGTCACGACTCCTCATTTATCGCAAAGAATGCTTTGATGATTTTCcattccttctttgcggtgt
ATAACTTTGTTGTACACTACAAGCCAGGCATGACGAACATCTTTGTTAAGACGTCCGTACTATGACCCAAAGTCCAGGAGCGAAAACATACacgagtcat
gtcgacaatgcgaaGATGTTCGGACGATCAGAGTACAAGTAACGACTACAGTGcgcgaagaaattgtcgaaggGTACAAGTATGATGAGACATGTCACGA
CTTGTTGAAGTATTTCAATTAACCTTCCGACAAAGCTCTGCAAGGTTTTCTTCTCGCACGAGATCGCGTGCTCACCGTGTTGGAGTACACAAAAAGATTG
TTGCACTATTCGGCATGAGTTGTTGTTCCAAATGACGAAAAGGTTTGCGTCATCGTATTTTATATGAGTACCATGACAGCCCTTCGGGTGGCCATCTCAG
ACGTGATAAAACGTTTCTCAGTCTATCCAGGGATTATTATCGGCCACATGTATAATTGGGTGCGCAAGAACTGGTGAGATCTGCGAGAGAGGGAAACCAT
CGGGTTCCACTCAGACCCCACTTCGGTCCCTGGAAGTATCAACTGACAGCTGTAAGTCCGTGAGTATAGACTTCATCTTCGGAATCCCGCGTGACTCACA
CGTACACAGTGGCATCCTTATGTTTGTGGACCGATTCAGCAAGATCGTTCATCTTGCGCCTGTTTCTGACAAGAACTCTACCGAGAAGACAGCTAAGGTC
ATTGTTGACGTTATTTCCGTCTTCATGGCTTTCCTGTTGAGATCGTGTCTGACCGTGACATCGTTTTACGTCGTAATTTTGGCGTGCACTGATTGGACTA
TTGAGCACCAAATTGTCCATGTCAAACAGCGGCACACCCTTAAACGAACGGCCAAACAGAGCCTGTGAATCGAGTCCTGGAAGACGTACTGCATAGT