Description :
From Genome Similarity Track
Location :
contig_5:473818- 475377
Transcript NameFunction/comments
g1368.t1hypothetical protein

Sequence
1559 bases(100 bases per row)
ACCATGCCGCAACGACTGACCGTCGCTAGTGTTGCGTAACGAAGTGTCTCCGTTTCCATCATGATCCACACGTTCGGAGGAATCTCAAGGCGTTCTCCGG
ACGGAAGCGTCAACAAGCGGTTGTCATCAAGCACGGAGTTCAGGTTTTCGGCCCACTCAGGGTCCACGTCGCCATCGAAAATGATCCAGTGACGCTTTTC
ACTCTCACCTCTCACGCTGTTAAGTACTTGACGGAGCAAGTACGTGAAAACTCCGTCCGTCCACTCAAGCGTAGTGTTATCAAGAACACCATACAAGTGT
TCCTTGGAGAGAGCCTTCGGGTCGATCACGTGAGCTTCCCCCTTAACACCATCAACAAGTTCCATAGCATTCATCAACACGCGCCAGGCGCTTGACTTTC
CAGTTCCTGAAGCACCAACAAGCATCACTCCGTGGCGAAGTTGCATGACCTGGTAGAGTTGCAAGGCTTTCTCGACCCACTGGTCGTTTGCAACGTAATT
AGCATTCTTCGCCAATTCCACAATTTTGGCGCGAAGATTGTCTTCGTCAATACGATGAGCATCAGTGCCCGGGAACACCCCCTTCAGCAGTGTCTCGAAG
ACAGGTACATCGTTAGAAACCAGCTTAGGCAAAATTGTATCCGTAATAGAGCCGATTAGAGCCTTGGTTTCTAATTCCTCGATATTTGCAGGTGCCGCTC
TGTCCTGTGATTGTGTGATCTTTCGCTTGAGCTGGCCAGCACTAACAAGCACGCTCTTCAAAGCACGAAGTCCGAAGTCGTAGTGCGGCTGCTTTGAAAG
TTGGTCTTCGCAAAGGTTGAACAAGAGCACAACCTTGGCAGAGATTTGTTCAGCAGTAGTAATACCCTGAGAGAACAGCATCACCTGCGCAATCAACTCG
CGATCCGGGGCAACCATTGCAATGCTACGGAAAAGTTGCTTCAAGTTGTCCGGCAGATTGGATCGACCAGCATATCCTGGATTCATCGTCACAAAGATGC
CTACGTCAGGATTCAGCTTTACACTCTTGCCCAGCAATTCGATGGTAGTGCTGGAGCCGTTTGTGATTGTTTGCGAGCTGTCAGCCGTCTTTCCGACCTT
CAACGACGACACTCCACTCTGGATCGCCAAAATTTGCTGAGAAACAGCAGATAGCACACGCTCCTCCAAGCGGTTAAACTCATCGAAACATCCCCATGCA
CCAACTTGGCACAAGCCCACAAAAATCCGTCCCATCGCTTGGAAATCGAAGTGTTCGTCACAGTTGAAAACCAACACAAAACGACCCAGGTGGGATCCCA
AGGCTTTAACTGACTCCGTTTTACCTGTGCCGGCAGGGCCAAACGGATTACCCCCCATTCCGAAGTCCAACGCCTGAGTCAGTGTGAGGTAGCAACGCTC
TGTGAGAGGAGTTTGCACCAGTCTCTCACCAACACCGAAGTACTCAAAGCCGTACGAGAAGCTTGCATTGGAAATTTGGATGGTAAGTTTCTTGAGCGGG
TCCGACTCCTTAGCTTGGAAGTAATGGCGCATATGGTACAACCAGCGGAAGTCCTCAGC