Description :
From Genome Similarity Track
Location :
Scaffold_548:4738- 9668
Sequence
4930 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTCGTAGCTCTCGTATCTAATGGAGTGAGCAATAAAACGAGCT
CACAAATCTTTGTTCTTCTGCTCGTGTACAAAAAAATATATTATTGTAGATTAATATCTGCAACGGCTCCGAAGATGCCGTCAAAATCATCGTTCAAACT
AAATTCTCCTATCTCCATGTCTAAATCGGTAAGGATTTCATTCAGGATAGAAATTACTGAATGTTCGCTGATGTCCCCACCCCTTGCCAAGTGGGCTAAG
ACCTCTACTTTGTACGTCGCTGTGAAGAATGACACGAGGTTCTTTCTCACTTTACGGCCTCGGCCTCCTGGAAGTCGTGGTCGCCCTTTTGGGTAGCGGC
GTTGCATAGGAGCCATCCGATAGCAAAATGCACAGACAGAAAGACAGTTCGTACGACTGAATGCGATAACTGAGGGTGCACGAGGTCTTTCCCGTTCGGC
CCCTAATTGAATGTCATAATGAATAGTACGTGATAACTAAGGGAATTCGGTATGTAGACTGGTTTCAGCTTATTTTACTAAGGATACTACTTTTTAACAC
CAAGATTTGTGACTGTACCTGTATCTGGTTTATATACAAACATCAAGTGAATGAATAATTTATCAGCATCCCAGAATCTGAAGAGCCGGTAGATCAGCGT
TTCTGCACGTGTGCCCTTTGAGAATTGTGTTTATTGTAAAAGGCACTCGTTATTCAGCCAGACTGAGTAACAAGAGACAGTACAATTACACCAGAATACA
CCCGATTAGCATGCCCGAATATGCCAGACTCAGGAAGAGCCGGACACGGCATCAGCTGATGTGTCTTCGGGAGTATACGTATAACCGGAAGCTCGATGTC
TGTCGGTTTCGAAACTTATATCTGCAAGACATTCACTGCGCTGGGGATATCTAACTCTCAAGACAAAGTGCAGGGTGAATAACCCGGAGGTAGTCATGCC
ATCGACACACACAAACAAAAGACCAAATCACTGAAAACTTGTTCAGCTAAATGCACATGCAGAGATACCGATAGCGTAGATACTGTAACTCCTTCCTACT
TAGCGCACGCATAGTAGTAGCACCGGCAAATATCTCGAATGCCAACAGCATGTACATGCCACAATTGTAGCTATCGACCTGCACTCCAAGATCACTTTCG
TACATTCGGACTCGGTACTTTCTTGGGCGAAGTCTGGTAGCATCGTCACCAATTTGTCAGCAAGGGGGCGAATCTTCACTCCGTAGCTGGAATTCATCGG
GTCGTAGACTAATATGTCTTTACATGTCAGGTCAATCATGACAGAGCACCAGTGATTCTTGCCGCAGATGATCGGAATCAAAATCTTCTCACCCGTAACA
CCTACAAACACGCCCTTCATTGGATAGATCGATAAATAGCCATTCATAACGTTCCCCGCGATGGACGTGTCGACTCCAATCGTGTCTACTCTTTCTGCAA
ACAGCTTCAGCACTAAAGTGTTAACGGGGCAATCATACAAGGGCGACTTGCCAACGAGCTCCAGCGCTTCCGCCTATATTCAAGAAGATGTTATCAACGC
TAGTAAACCCATTGTATCAATAAATGTACGTTAACTGTACCTGCACGGACAGAAGTGGGATGTCCTTCAGCTTAGCAAGTATATCTGGGTCTGGATCAAC
TTGGAAATGCTCGGGCATCTGTAGAGTGAAATCAATGGTCTCGATCCAGTTTATAGCTTTGTCTACGTGTTGTATGCTTTTCATCGCCCTGTGCCACTTT
TTCATTACACCCAACGTCTCGGTAGTGTAT