Description :
From Genome Similarity Track
Location :
Scaffold_11:473721- 492045
Transcript NameFunction/comments
Phyra_75191Hypothetical protein
Phyra_75192Hypothetical protein
Phyra_75193conserved unknown protein
Phyra_75194putative duf410 domain-containing protein
Phyra_75195pre-rRNA-processing protein ESF1, putative
Phyra_75196Hypothetical protein
Phyra_75197conserved unknown protein
Phyra_75198Hypothetical protein
Phyra_75199unknown

Sequence
18324 bases(100 bases per row)
GCCTTCTCGACCATTCAGAACCCTGCCAATTTCCAGTCCCTTATGCGGCTGAACCGGCAGCGCCGTACGCTAGCTATGCAGCACGGAGATCGCGAGCGAG
CTGTATGGAAATGCTTCGTGTTCGTCGGACGACAGCTCGCTGCGATGCGCACGCGTGTTCTTCAGGTGCAAATGCTGCGCACGTTTTCAGAGAATCCGTT
GGCGATGGAGTTGGACGCAGAGCTGAAGCTGTCGGCTGACCAAAAGCTGCAGCTGCAGTGCCATGCTCAGCAAATGTTCAACCAAGAGGTGGTGGAGCTC
ACGAAGCTGTTCAAGATATTCTTTGCTCTCCGCAATGAAGCTCTTCGATTGAACATTTTGTCACCAACCCTGGAGCGCTACTTCCGCGAGGCGTGCTCGT
TCGACCAGTTGCAGAAGCTGTTGCAGTGGTCGGAAAGCCATCGCACCGTCATCGAGACGGATCTTTTCCTAGATGAAGTTTAGGAGCGTTCGGCGCGAAT
AGTTGTCAAATTAACTCTCAGGAGAACCGAAGCGTGTAAGGCTTCGAGCGCAGCGTAACGTGGACGATTTTGTGGACATCAAGAATCGAATCCATACGAG
ATTTGTACCATGTGCACGAAGACTTTGACTTCCCAAGTAACCTGGATCAATGGTAGTCGAGGTTGACACGGATCGCTTATATTTTGACATCAACCTTCTC
TACTGATTCTTGACAAAACTTTGATGCACAAGGCGGCTGACCAATACTTTATGACGAATGCCATCAAGATCGCTCATGCAGCAGTTTTCGCCGTCAATTC
TTGCTTGATTTGTTGCAGTTCCTGGAGTAATTCGTCAGCTGTTGGTCGGACCTCAGGTTGGAAAGCTTGACACCTGAACATCAGAAGACGTATCTGCGTC
GGCGCTTCTCCGTCTGCCGAATGCTCCTTTTGAGCATTGTTCAGCATCGGAACGTCAGTGTCGTCCATGACCGAGTGCTCGGCTGAAGAGCATTCATAGG
TAGCGAGCTGCGCGAGCAACACGCCGAACGAATAGATATCAGCTTTTTGTGTGTACTGACGGCCGTCGAGGACCTCGGGAGCTGTCCAGACGGTCATATC
CATGTGAATTTCCTCGCCCGAGGCTTGCGAACTCGTGGTGCTGCGTCCCGAACCTCTTGCTGAGGGCCCAGTCGAAGACGGTGTGTCGTGCTTGTGAGAA
GACGACCAACGGCGCAACGCACTGCAGCAAGTCAGGTCGCCAAGCTTCACGTTCCAGTCGCTGTCCAGGAAAACCTTGCGAGAACTAAGGTTGCCGTGGA
ATAATGGAGGCGAGAACGAGTGCAGATATTGAACCGCTTGTGCGACCTCAATCGCGATAGATAACTTGCTTCTGTAAGCATCCGATGAGTTCCGCCAGCT
CCACCTGCCTTGGTCGTCTGAACTAGTGACGTCGTCATCCGATTGAAACATGTCTTCTTCGTAGTCGTCGTCACTGCCATCACCACTTATCAAGTCGTCA
TGGACCTCGTCGTCCCAGCCGACGTGCTTGACCAACGAATTGGTTTGTTCTTGCATATTTGCACGGGCTGGTCGATGCTTGATCTCTGCTTGCTTCTTCT
GCAGAGACTGTTTGTGGCTCTGAATAAACGCGTTCAAGTCACCCTTGCCCATGTACTCCATCACAAGCGCAACACCTCCACCATCAATTGCCTCGATTTG
GTCTGCATGCGCCATCTTGACGAACCCATAAAATGCAACAAGTTGCGGGTGGGACAGCCAGAACTAAGTCGAATCTCCCCTACGAAAGCCCACAGCTCAC
CTGATGCACCACTGCTCCGTTCTCCATTCTTGTGTCTGGCGATTTCTAGTGTTTTCAAGGCGACCGTCTTGCGGTGGTAGACGGCTTTGAAATAGGCGAA
TGGGGACGTGGTTTCTCCAGACCCATGGTCTGTCGGTTCTTTTGCTGCAGACAAAAGGTCGTGGTGCTTGATGTGCGATTCGTGAATTTCGCAACGCTGA
AGCTCTTCACTGAGTCGTGTGAGAGGGTCACTCGGTTGTTCTTTCTTCACTGCCGAATCACCTTCCCTTACGGCCGGCTCAAGCTCAGGCTGGATGGAGT
TTTCGTCTGTAATCGTCGACGGATCGGAAGACAGCAAGTGACAGACTTCATCGCCTGGTTCCATACCCCCGTGCCAGAAGTGGTTGGATTTGCCGCTCGC
TGTTTTACCCAAGGCCGATTGAGCACCCGTTTCTTTTGAAGGCCCACGCACTTTGCGTCGCAGACACAAACAAAAGGCATTCACCAACAGCAGAATGGAG
AAGGCGCAGAGCAAAGCAGCAGCGCCGATGAGAAACCATGACCGTCGTTGATGAAGCGTTTCTTTCAGCGCGATCCGCTCTGTTGCTTGACTAGACACAC
CATCCATTCCCCACATCGATCCCGACGTAGAACCGCTCGAAGCTTGAATAACCACGCTTTCGTACTTGGCAGCAAACTCGCTGTCTGACAACACGCACAA
CATGGTGTCTTGTACATATCGCGGATTGGCGTTGGAATCGGAGCAACTGAGAGTAGACGTAGTGGAAACATCCCATAGACTCATCTTCTCGAACATATCA
GCGTCACTCTGGCGCACTTCGAACTCCTCGAGCACACTAACGGTTTGAGCTGCAGGATCCGTAGCAACCGTTCGTAGAGCACGAGCTTCGTTGGGAGTAG
CAACTGATTCTGTTGCAGTGGTAGTCGTAGCTGTTGCTGTTGCTGTTGCGATCACAGTCAACCTCGTTAAAGAGTTCGGGAAAATGACCCCTCTGATGAC
AGTAATAGGGTTACTTGAGAAGTTGAGCGTCGTCACTGAACTCGGAAAGGAAAAATTCTCGAGCGTAGCAATACTGGAGTCTACAAAGTTCCTGTAAAAT
AAGCAAATGTTAGTGCAAGGGTTTGATAAAGAGTGAGTCAATGTAAGCACGTGCAGCGGGAGCTTCTTCCAAATACTTACAGTTGCTGTAAGCTGGACGG
AAACGATACGTTGGATATCGAGCCGATTGGGTTGCCAGACAAATTACTGCTCCACAAAAACAGTCGAGATCCTTAGCCGCAAAATCTCTTGCTACTATAT
CTATGGTGACCGGGAAAGCTTACAGATATTGCAGTGAAGTTGGCAGTGCAGCATTGTCAATGTCTCCAAGGGCGTTATTCGCGAGGTCCCTGAAATCAGA
AGTCGCGTCAGTACTGCTTTCAAACTCACACAGGGCCAAACAAATGGCTCATACGGTGACATACAGAACAGTAAGACCAGAAGGGAACTTGAAGTCGTCG
AGCGAGGAGATGGTGTTGTTTGCTAGATACCTGGCAGTAAAAAGAGTAGCAATGGCACCAAGTTTTAGTTCGGAGGCAACACGTCCCTGTCGACCGCAGC
TTGACTGGGGGGAAAACACGTACAATGCCGAGATTTTATTGGCTATCGTGAACGCACGGAGCTGGTTGTTGTCCAGCCTTCTGCTCTCCGCACACATTCA
ACCCCACGACATTAGACAATCAAAAGAACTCCGCAGATAATGCAACGCACATAGTGTTCACCGCCGGCAGACTCTCGACAGCTGCGATGGCGCGACTGCG
TAAGTCGAGAGTCCTGAGCCCAGCAGAACTGGTGGTGGCCTTCACGACGCTGGACTTGCAAGTGGACGCGACTGTAATCTGCACATTGCTGCTGCTACTG
GTTTTGGTGGCATTGGAGGAGCTGCCATAGATGGAGACGGTGGTGACGTTCGGGCACGAGGAGGATGCGCTGTCCTCCGCTTCTCCCACGTCCACAGCCA
GACACTTCTGAGGCCATTCGGTAACCGCCAATAGCAGCGCCAGGAGCACCACAAGAGCGAAGTGGCGCCTCGAGGTCATCCTTCCCGTCGCCAGGACGAT
GCTGCTCAGTGGGTGTTCAGTTCTATCCAATTGGATAGTCGAGCCGTTACGAATACTGAAAGCAAGTCAAAATGAGGCTTAGGTGTAGCCATTTCAGAAT
ATCTGCGACTTGTGCAAAAGGCAACTACTGGAGTGTCTTCTTCTGGGCGCGGATGGCTTTCTGCTGGCTCCACTCGACGAGCAGGGCCTCTTTGTCAGCG
CATTTACGCTCTGCCTGCTCGTGTCGATCGATCTCATCCTGCATTTTCAGTTTCGAGATGAAGTAGGCCGACTCAGCTTGGTCCAGCGATCGGCGGTCCT
TCTTCAACGCCGCCTTCGCCGCCACCTGTTCGTTCAGACGCTGGTTGAGCTTTTGCTTCTCGGCACGTCGAGTCCCGTCGCTGATCTCACACCCTAGCGG
CAGGATTTTGACGTCTCGGTAGGTTGACGCCGACTTCTGGCGCGAGCGACTCCGCTTCTCCTCGATCTGGTTGCTAAGGAAGGCGTTTAACTCTCGCCTA
GCCACGGACTGCTCCGCCCGCTTCTGCAGGTCATGGATCTGCACAACGCGCTGGCGCGTTACCAGCATGTCGTTAAAGTCGTCGTCCACGCGCTTCGCCT
GCTCGATGTTGGCCACCTCGCGCTGGAACGCGGCTTGCACAACTTGGTCGTGGTTCCGACGTGCCTTAAGCACCTTCAGAGGGATACGCGGCTCTGGGAT
TAGGAATCGCGGCAGAATCTGTCGTCCGTTCAGCGATACCGGTTCGGTATTGATGCTGTCGACGGGAATGGTCTCATCCAGCTCTTGTCTGTGCCTGTGA
CGATGCCTCTTTTTCTCCTTCTCTTGTTTCTTGCCGTTGAGGTGATCTACGTCTGTCACGTCATGATCACCACCTCGGTGATTCACTGCGGCGTCATGCT
TCGAAGTCTGATGCAAATGTAGCGCCGATGTAGCGTGGTGCTTGGAGCTGCTCTGGGCTTGAAGGACGCCATCCAGAGATATCGAACGCTGCAGTAGCGG
GCTTTCTCCTTTGTCGTGGGTTCTGTGTGTATCGAGTTGCATTGTCTTCCTCCGCATGTTGTCAAGCGCACTCCTCTTGAAGATGGCAGACGGAGGTGGT
GTCTCCACGTGATCACTCTGCATGATCCCGCGAAGCAAGCTTGCGTCAAAGGTGAACGAAAGAGCTCTTCCGTCAAGCGAAAAGCTTCCAACCCCAGGAA
GGACCAATCTTCCAGCGCTCTTGCCGCCCTGCAACTTCTTCCCGATAAACGTCAAAATGGCATCAAGAGCACGACGTGTTTGGTCGGATCCGAGCCCCAC
ATCGTTACCGAGAGCAGACATATTAGCTTCCGTGGTAGCGGTGAGCGGTGCCGGTGGTGGACGGTGTCGCCACACGACGCCGTATGTCGAAGCAAAGCGA
TCTGCGAGCAGAAATACTGGAGGCTGCATCGAGCTCTGCACCTTGTAGAAGCCAAACTTCCCGAGCTGCTGTAGAGATACCCCCTTTCGGTGCGTAAGCT
GTCGACTCACATGTCGACCTAGTGCCTGCCACACGCTCGTCACCGACGCGCCCAGCAACACCTCAAAGTCGAAGCTGGACGCTCGAAGCTGCAGCGCGCA
CTCAGCAAGCAGATCGCCAGCCATGATCCTGCAGCCACGGTAAACACAGAGCAGACTCAGCACCCGATGAATGAACGCTTGTCTAATATCTCTCACTTAT
ACTGATCTACTCGACAAGAAACAAAGGCAAGCTATTCCTGTTTGGCGTAATGTTAGCTGGAGTTTGGCTGACGAGGCATCAAAGCAAGCGTTCGTTGCTC
ACGGTCGAGTGAATACGCGAAGACCTGACCTCCAAACGTTGAAGCCAGCAGCGTGCTATCGTCCACCTTGCACATACTCGTGAACATGCGCTTGGCTCCG
TATGCATGTGCTTCAGCTAGTGGGGAAGTCGATGCTGCATCCCACACCTTCACTGTTCCATCCTTGGAGGCAGTCACCGGCAGCATCGGCAGCACTGCAG
ACTCCACTTCAAGCTCGCGGCTGTCTGCTGTACGGGGCAAGAAACAGCAAGCTGTTGCGTCCTGTTGGTGTCCTTGGAATTCTACGACCTGCTTCTCTGT
GCGTCGATCCCATACTCGTGCCTCGCAGCCGACACTGTTGAAGCCCTTGCTAGAAGTCAGTAAATACGTGCTATCCTCTTCACTATCACTGCCATAGGCA
GCAATGCTCAGTGGGAAGTACACGAAGCCCCGCAGCATTTGCGCGGGCACGCGCAGCGGCGTCCGCGGATCCCAGAGTTTAACGCTCAAATCCTCACTGC
CTTGGGCAACTAAAGCTTCACGCGGCAGCCACGTCGAGCACGTGACGACGTTCTGCGGTGTGGTGTTCTTAGCCGCAATGTGGCTAGTGGCCAGGTCCCA
GAAGATCGTTTGGGTGTCTCGTCCTCCAGAGCACAGCAGTTGCTCGGCGTCATCCACCGCAATCGTCGACACGTTCAATTGGTGGCCTCGCAGCACCGTT
GCCGTCTCCGAGGCAGGTTTATCGGAGATGGGCGTGATAGCTACAGTGGTGTCTCGAGAGCACGAGTAGATCAGCTGCAGCTGGTCCCCGATCACGAGGC
GGTTGACGGCGCGTGTGTGGGGACTCCAGACGCTGACGACGTCACTGGCTGCCGTCCTCCAATTGCGTCGCTGGATGGAGCCGTCCTCCCACGCTGTGAG
GCAATCGCCGCCGAGGAAGGAGCTGTAGGCGACGCAATTGAGCGCCAAGTCGCTCTCGTGAGCAGCAGAAACAGCTTGGTCATCTGCGCCCGTTGGCGTC
GCTGCAGCTCCGTCGACGCTTGTGGGCGTCTCGTCCTCCACCTTCCACTTGGCGAGATTGCGAGGAGACCTGTTGGCGTCCTTGGACGTGCACGCGCCCA
TGGTGAACAGAGTGCGGCGGGCTCAGCTACACGCGAAGTGTACGGAGCCCAAGGTCAAGTTGCATCGTCCTCGCGCCTGTCCATCGTTTGCTGTAATTAC
AGACGTTTTAGGAACGACACATATATTTTGTGAACAAGGTACACGTTTAATTGTGCCAATATATTTGTGACGAGCGGCTCACGTGCGTCGTTCGCCACTC
GCCATCATGTCGGCCGCGAATCAAGTGACGCGCACCACAATCCAGGTACGTAGAGCTCTTCCTGCTTGCATGGCCTCCATCTCATCAACCTTCACGTACT
ACCTATCTGCAGCTGTACCGCGACTGCATGCGGCTCGCCCAGCACATTGGTGGAAACGTACGTGGATTGCGCATTGATACAAACCCTTTTGCGCTAGGAC
TATTGGGAGCTGACTTGCTGTCTATTGTTTGCAGAGCAAGAAGGGGCAGGCCATTAAAGACCTGGTGCGACGGGAGTTCGCCAAGGGCCGCGATGAGACG
GACCCGGAGAAGGTTGAGGCGCTCAAAGCCAAGTACGTTTGTTGACTGGATGTCGTGGACTTCTGTATGCTCTGACACTATACGTTATTTGTTTGTTGCT
GGTGTAGTGCTATCCGCGGCCTGAGCAACTACCTGATGCTGGCCAACTCGAGCAAGGACCAGCGGCTGCACGACGCCATGAACAAGAAGTCGCCGCCTAA
GAACGAGGGCCCCGACCAGGCCGAGTACCGGGACCTGTAACTTAGCAGCGTCGACGTTGTAAGGGGTCAAAACACACAGTATCCTTGTCCTTGAGCCTTC
ACTTGCCCTCAATATCACAGCCACCTTGTACATGCAGATAGACTGATGGAGTGATGCCAATGACTAGTTTCGTTCACAAATGGGACTATTCCGGACCAAA
CCTCAGTTTTGACCACAAAAACGTATCCGCCAATATGAATCGCCGAGCATTGGCACGGCAGGCTGCAGGCGCCAAGGCGGCGGCCCCCAGCGGTCTGAGC
GCCGAGAACGTGGGCGTGGAGAACGTGAGCAAGAAGCTGGAGCTGCAGTTGGCGGCTGGGGACTTCTACGGCGCGCTGCAGATGTACAAGACGCTGTTCA
TGCGCTACCTCAAGGGGGACGAGCCCAGCACCGAGCAGCAAGAGAAAGCGGCGACGTTGGCGCTGGACGCGGCGCTGCAGCTCATCGCGCACGACCAGAA
CACGGCGGCCGCGGAGATGGGCAACCTCATGCTCTCCGTCTTCGCGGACTTCCGCCACCCAGTGGACGAGACGCACAAGCGGCGCATCCGCCAGCTCGCC
GCCGCCTTCGAACCCAAGCCCCAGTTCAGCGTCGACCTGGCGCTCGTCCTCAAGAACGCAGTCAAGTGGTCGGCGGCTCACGGTGCGCGCAAGCGCGGAG
ACCCGGAGCTGCAGCTGCTGCTGGCGCGCGCCTACCGCACGTCGGGGGACTTTACGCACGCCATGAAGCACTTTTTGCACGCTGAGAACCCGCAGGAGCT
GGCTGAGGTTGTGTTCGAGTGGTCCACCAAGGGATACCCTAGTGAATCCGACTTGTACCTCGCTCGCGCGGTGCTGCAGTAAGGAGATCGCTTGCTTTTA
AGTTGGTGAGGAGGTTACTGAGGTGTTTTTGTTGGTGGTGTGCAGACTGCTGAGTCTCGAGAACCTGCGCGACGCGAACAAGGTGTATGAGGTGTATGTG
GCCAAGTGTCAGAGCGCTGGACGCCCTGTGGACCTGCCGTTGTTTAACTTTACGCGGTTCTTGTTGCTGACGCTGGAGGTGAGGATGTGATGCAGCAGTA
GCAGGGCCTCGGACGTCGAACTGACTTCGCTTTGGTTTGCTAGCGTGATGCACTTCCCCTTTTCCAGATGCTCCAAGAGCGGTACGCGCCGGCACTTGCT
CGCGATAGCAGTCTCAAGAGCGTACGTAGTGGCTTGGGATTTGAATCTCTGGAGGAGACGCGGCTGACGGAAGTTTTTTTCTGTTTGTGCGCTGCAGTAT
TTAAGTGTCATCGGCCAGAAGTTTTACGGACTTCAGCCGCCGCGATCGGGACTCAGCTCCCTGCTTGAAATGTTTTCAGGCGGCATGCAGTAACAAGCTA
TACGTCGTAGTATGGCTCTCTCGGCTGCACGAGGAGTGTGCAGCTACCTTTTCGCCCTACTCGAGCATGGATTTTACAGTGAACAAGAGCGTGACTTGGT
GCTTCACAGCAGCTATGGTCAAGTGATGATAAGAACAAGTTGAAATGGGCTTTGGGCATCATATAGGCGTGTTGGTTTGGGGGTTGTCCATCTGCGTCGA
ATACCCAGCAGCGCTTCAGACTATCATTTCCTCAAAGTCGTCGTCGGGCGGTAGTAGTCGCCTCCGGGCGAGTTTGCAGTAGCGGGTTTGGCAAGCGCCC
GCGCCTGCTTCTCGATCTCCTCAATGCGAAGCAGCGTCGCCGACTTGATAGGCATGATCTTGGGTTTGCACAGCACCTCGGTCAGATTGCCTCGCTCCGA
GTACACAAGCCCAGCCTTGGGTAACACCTCCTGGATCTGAACACGCTGCGCTCCAGCCGATTACCATCAATTGCATGCCGCACCTACCAAAGCAGGACTT
ACCTGCATGCTTCCGTCTTGCTCTGTCGTGCTGTGGGGATCTACGAATGTGACTCCTCGTCCAAGTCGCCTGCTCAACAGTGTCAACCGAAACGGAAGCA
AGACTACTGTATCAACGACAAAGCAAAACGATTGTCTATATACTTGGACCATTCTCCGTCGCTCGTCAGCGTTGGGATTTGTGGCTCATCGTTTTCTACG
CCTTAGTCTTCTTATGCTTTTTGGCCTTCTTCTTGTCTTGCTGCTGCGACTTTCGCTTGAGGTTTTCGACCATAGCGTTCAGCGACTGCTTGTTGTTATC
GCTACTGGCAACAGCCGCGGCCGACTTGGCAGGCTTGGCCTGCGTCGCAGAAGTCGAGCCGTGGTCATACCGTTGCCGCCGCTCCTTGAAAATGGCCTGC
GTGGCCTCCGTCTTCTTGAACTTGGGGTCTGTCGGGTCGAGCTGGAACTGCGAGCCCTTGGCGTACAGTGCACCGAAACGCGGGTCGGCTGCGTCGAACT
CGAAGCCCTCCTGCAGCCCACCACTCGCCTTCTGCTTGGCCAGCTTCTTTATCTCCTTGGCGCGACGCTTGCCCTTCAGACCCTTGACCTTCTCCTGCTT
GGAGATTTTCTTCATGTCGAAGTTGCGCTCGTCCTGATCGCTGTCACTGTTGCCACCATCATCACTGTCGACGCCACCGTTGATAGCCTCGCGCAGCAGG
TTCGCCTCTTTGGAGCCACGGCCCTTCTTCTTGAGCACCTCACGTTGCTCACGCTCAAGTTGCTTCTGTTTTGTACGCTTCTCGTGCAGCTTGCGGTTCT
TCTCCTGCTTCTTCTCACGCGAGTACCGCTCGAAGGGCGTCTCATTGGCCTCAAGCTCCTTCTGTCGCTTCGCCTTCAGCACGTCACTAGCACCAGGCGT
GAACGACATCTCCATGTCGCCTTCAGCACCACCATCCTCCTCATCACTGCTGTCTCCCAAACCTCCTTCAGGGGCATTTTCGTCGTCCTCATCTTCCGCG
TCGCTGCCCAGCAGCATCGATCGGTAGCGGTTGCGCAGCTTCTTGATCTTGGCCTCCTTCTTAGCCTTTTTCTTGCTGTCGGGAGCATCCGCACCGGCCT
CTTCCTCCTCGCTGTCATCGCTATCGTCCTCAGCTTCGGATGCATCCGACACGTCCGAGGCTAGGTAGGCCTTAAAGTCGTCATCGTGGGCATCCTTCCA
TTCAGTCGGACGCGTAAGCAGCTCCAGACGCTGCTCGTCGTCTTCTTCCCAAGTGAGCTTCACATCCGTCTGCTGCAGCGCGAGGGTAGCGAAGATGGCC
GGTTTGTACCGATCGGGCACGTTGTCACACGCCTCCTTGGGCGTGTTCGTGAAGGTTGTGTCGTCCGGCACGTACCGGAGATCAAGCACGTTGGAGGACG
TCTCGTACTCGAGCTGGTCGCACTGGTCAAAGATTGTGCTGGCCGTTTTCACCGAGTCGCATGTCACGACAGCGTAGTAATACCGCAGCTTCTGCAGCTC
GTAGTTGCGCAGCTTTTCGTGGTCAAAGCCGTCCGATTCGCCTTCGATTGTCACGCTCTTCTTCACTCCCAGCGGGTCGTCCGAGTCGTAGTCATCCTCT
CCTTCCGCGTCGCTGTCTTCGTCACTGCCAGCCTTGGCTTGCTTTTCCTCCTCCTCCTCCTGCTCGTTTCCGGTGTTATCACCTTCGTCACTATCAACGG
CCTTCAGTTTTTCTTCGCCTTTCGACTTCTCTTCACCCTTGTCGTCCCAAAGACCCTGCGGTCCGTGCTGCTCCTCCTCTTTCTACAATCACACCTCAAG
CATTAGCAGTCATTCACACAGCACCACTCACAACCAGCATTCGTACCATTTTCTCCAGACCGAAGTCCGACGGATAAATAGTCACATTCTGCACAGCACC
TGTAGGCGGTGCAAACGACTGACACAAGGCGAACAAATCCACGGCGCGGATACGCGTCCAGTCGCAGTTGAGCACGGCAAAGCGCTTGGTCTCATCGCCC
ATAGGGATATCTTCCTCCGGTTCCTTTTCAGTTTCCACCGGCTCATCATCGTCGCTGTCGTCCGAATCCGAGCTGTCCGAACCCGACGCGAGTTCACCGC
GCGCCATGCGGTTCAAGTAGTCGAGACGCGAGAGCTTCTCGCTGTTCTTGGCGACGGTGGCGTCCGCCTCATCGTCGTCGTCATCAGAGCTCGTCGTAGA
CGAAGCCTTAGCCTTGGCCTTGCTCTCTTTTTCCTCCTCTTCCTCTTCTTCTTCATCTTCTTCCTCTTCTTCCTCTTCTAAACGGTAGAACTTCTTCAAC
TCGTTGTCCTTCTTCTCGATGCGTCGTCCATACTTGTCGTACTTTCCCTGGACGCTCTGGAAGCGGTCGTCCTTGAGTGCCCCGGCGAAGCGGTTATCGA
TCTGCAGTTTGCTCTTGCGCTTCGAATTGCGTGCGAATCTCTGCGTACAAAAGCGTGTAGGGCGTCAGCACAAGCGCTGATTGCATCTACATATTATCCT
AGTGCTACGATACGTACCGGGTCATTGTGCACTTTCTGGAAGCGCTGGTCGCGCACGGGCTCGCTCATGGTTGTCACTGCGACGACCGGAACGGAGGCAA
GTTGAATCGTTTGAATGGCCATTGGTGGCGATTGGCCAGCACCACGAGCAACATAATATTGCAGCAACATGTTCAAGCAACATAATACGTAAGTTGCATT
AACGATGAGGAGCAACTTGGGCTGCCTTGTGCGCAACATAAAAATAAAGCTGAGGAAATCGCAGTCGTTCTACCATGTGTTCGGCACTGCCGAATCGACA
ACCAACTTGCACTTTTTGTAGGGATTCATCGCAACTCCAACTTTTCGCGATGTGCTCTTTGTGCAATCGATCGAGTATACCACAGCCTTCACCCGAAAGA
AATTGAAGAACCCGAGGCTGTGCTCGGTTTCTCCATCAACGAGGCGACGGGACAGCTCATGGCTGGAGCACGTTGGCAAAGTAGTTTGTGGCGAAAGAGC
TTGTTGCTGCCAAAGAAAGGATTTGAAAGTCTACGTTCTCGCAGACAAGACAACAGGGGCAATTGTTGATCTCACTAGGTCTTTCCAATCGTGCTTGGTA
ACTACTGGGTGCTGTAGATGTATGCACACTAGATTTCAGGCTTGCGGGGCGTAAGCGTCCTTGTCGTGGGCTCGTGCAACCCATTTTTGGAGACCGACGG
CAACAATGACTTGTTGTTGAGCCCTGACGGCATTTCAGTGGAGCCCACTTCAACTTCAAAACTATCTATACCGAAGGGGTGCAAGTTGCACTGCAACATC
CCACGCGCGGCAACATAACTCGAATGCGCAACATACCGATCAGAAATTCATCTGGTCGATGAGTTGATGAGGCAGCTGGCTTGCATGATGTGCCGCGGGT
TCCTGCCGACTTACGCGTCGTTATGACTCAGAGCGCGACTCGCCCCAGCAGCGGAACATCCTTGGTGAGAGTTGTCCTGCCACCTGGCTACCCGCCGATT
TATGCTCGCATGTCCACCAAGAAGTGCCGACGTCCAGGACAAGTCGCTTCATAGTCGAATTCAGTCGCTGCTGAGCATGCGCCGACGCAGCAGCTTAGGC
GGCAGCGACGACAGAGCGTCGCGTGTCAGCGAGCGCTTCACGAACCCGTTCGCGCCACTATCGCTCTCGTCCGAAGCTGTTTCGGGGCTGGAGGCGCTGG
CGCAGACGCTCGTGGCGCGGAACGTCGACGCCTACGAGCGGCATCTGCACGGTGGTGCACAGGTGGACAAGACGCGCTGGAAGCTCCTGTACGAGCGAGG
CGGCCTGCGGTCGTACGCGGAACGAGGCAGCGCAGACTTGTCCTTCGGCTTTGGCGCGGCGTTCGGGGCTGCTGCAGGCCACTTGGACCGACCGGTGTTG
ACGCAGTCGTCGAGGGCATCAGTGCCGTCAGTTCTGGTGCTCGGGTCGATTGAGGGAGAGCTGGACGACACCATGTACGGCTTCATGTGCCCGACGCTGG
ACCAGATGCGAGTCAAGACGTCTTATGTGAAGGACGGGCTCGCTCGCGGCAGCGTGTTGGCCACGCTCGTGTCCCCCACGGTGGAAGACCCGTTCACGTC
GGTCGCTGTCAAGTGGATGGAGAAGGGTCAGCCAGCGCATGCTCGCGCCGTGGTCAAGAACCGCGACTACGTGTACCTGGAGGCCACGGGCGTCGAATAT
CTTCGCAACGGCGAGCGCGTGGGGTACCAGGTTGTCCACTCGATCCAATTCCCAGAGACGCCGGTGCGCGCGTCGGCAATTCGTGGCAACATGTCCATCT
GTGCGTTCTACCGTCAGAGAAATAACGACGAAACGGAGGTGTACGTCAAAGGCTTTCTCAATCCTGTGAGCGGCCTTGAGAACGCCATCCTCACGCGCTC
CGTCGCTCGAACGCTACTGTCTGTCTCCAGAAACGTCTACTGCTGTCAGATGAAGAAGATCAAATGGGCCATCCGGCAGCGATATCGATCCGCGTCAGTA
GATAGCCAAACGGCACTCGCCCAGGACTCGAGAGTTGACGGTCCCTGCGTGACCTGCGGGAAAAAGCGTTCCGCCTTCTCGAGTCTTGTCGCCACCGCCG
CTCGCCGAATGACCACCGGCAAAAACTTCAAGTGGCGACGTCGGTGTAAGCTTTGCGAGCGATACGTGTGTCCAGACTGTCGCAGTTTGCACAAGTTGAC
GTTCGTTCTACCCGACCATCGTCTGGTGCAGCAGCAGGTAGCGCTTTGCACCGATTGCCGGGGAAATGCGCTTAGCGTGAAGGCTGTTGATGTCGCTCGT
GACGAGCTGAAGCGTAGACGCTCGTCGTTGTATGAGTGGAGAGATACGTACGCCACCTCGACGAGCTCGAATCCGGTGGCGATCGACGAGCTGAACTAGC
AGCAACTGGCCCCGCACATAACTAATTATCCTTCACAACAGTAAATAAATCAATAAACAAAGTTGGTGAAACTCACGTCATTCGAGCTCGCTGGAGACAG
TCGCTCGAGCTGAATAAACCCAAAACTGCAGAAATCATGTGTCCTCAGATACTTTCGGCCTTTAGTTACCAAAACCAACCCTGCTGCTGCTTGCGTTTTT
CCTGCAGGAGCAACACACCACACACAACTCGTCAGGAATGAGCAATTATCACGCAAATTAAGCAAATACCCACCTGAATCGAAGTGACTTCCGCTGGCGT
AAAGTTGAGAACGGTCGCGATGGCCTTCTCCATGTGTTCCTTAGCCTGGTTGTATTCACAAGTAGGGAGACGGCATTAGCCCAGGTTGATAGCATCCTAG
CACTACATATCCAGTTCTGGACGTACCTCGTCTTGATCCGAGGCCATGTACTTGTACACTATATTCTTCAAATACTCGTTTGTCTTGGTCGCGTTTGGCG
TCTCGAACCCCGATAGGCTGCTATTCGACTCCATGCTCATGCGACGAACGCGAATTTCCTTGAAGCTGTTAGTGCGGCTCGCGTTACTGCTTCCACCACC
ATTTTCATGATACTGCGCTTGGATATCGCTCAGCTCCTTTTCCTTTTGTTCCACGGCATTCAGTGCACGCTTTCGGTACTGCGCGAACTCTTGGCGCAGT
GACTGCAGGTCGCCATTACCACTGTCGCTAAACCCACCATTGGCCACCAGCTTCAGTTCCTCCACCTTCTTTTCTAGCTCTTGCTTCTCACGAACGGACT
GCTCATATCTACAACGAAGAAATGGAGTACAGTCGTCAGATCAAGCATAGTCAAGATAATGCGACTGTACGCAACAACACACCTCTCTCTCCACTCCATC
GCGAGGACCGTTCCACCCATAGTGCCGCTGAGTTTCTCGTAATCTTTCATCAGCTTGTCAAACTTTCGTCGCCAATCGGATTCCTATAAGTCAGTCCAGG
CCACAAATACAGTGAGCGTGTGAACTCAATATTAAACGACAGGGTGCACCGTACGCGCTCCTCTGCTTCTGCTTGCGCCTTCGTAAGTCGGCGGACTTGC
GCTTTCGACGACTGCAACTCCCCAGAAAGATCCGTCTCCAAAATTTGCTCCGTTTGTTTCGCCATTACATTTGCACTCATCTGCATCATCAGCGATCGCA
ACGTTGTTCGATAAGGTCAGTACCAGTTGCAAATGGAGGAGTGCGATCATGAAGCAACAAACCTTTCGGATCTCAGCATCCTTTTGCTTTCGCGTGATTT
CCGACCTCACGCGATAACGCCGAAACTCCTCCTGCACACGGTCAATCTCTTCCTTCAGACTCTTTTTCTGTAGACAGCACAAACTCTCAGCATAGGTGTC
CCAACCGTGAGCGCACTGAGCGCAAAACGTACCACGCGCTCCACTTCATAGGGCGTGAGTGAAAAGTCCGGGAGCGTAAGAGGCTCCCCCGACGCTCGAT
CAGCGTACGCCTGAATCTCTCCCTCATCACGAAAGCAGTGCCAGGCAAACTCCTTCGAGTCCTCGAACTCGATTTCGTCCGCATACTCAACCAAACACCA
TAGCAGGCCCCCATGAGAAACCTTGTGCAGCAACTGCCTCGGACTGCGCGTGGAGGCATCCACAACCCACGAGTGTCTGGCCTGCTGACTCTTGGACAGC
TCGTCCCGCAGCTTCTCAATGACCTCGTCCTTCTCCACCAGCTCCTGTTTGCTGTTGTCAATACTGCGCTTGGCCATGGCCAGCAATCGCTTCAGCTTGG
TCTCCTACAACCGCCCACCATCACTAATAATCCCTGTCGTGTCACTGCAGGCATAAAACCGCTCACCGTCTCCTCCATCTCCTGCATCTTGCCATTCTTC
TTGGCGAGCAACTGTTCCATGCGCATGCCCCGCTCTTTCCACGCGCGCAGCTGCGTCGCCACGTCCGCTCCGCCATTAGAGTGCGGCGGGGAAGGCTGTT
GCGTCTCGGGCTCTTCGACTTGGGGGTCTGCAGCTTCCACACAGCGAGCGTCAGAGCGTCTTCTCGCCCCCTTTAGACTTTTAGTCAACGGCACAGACGC
ACGTACAGTCCCCTTTTGTCCTCTTACCTTCGGCTGGCGGCTCGGCGGCCGTCGGTGAAGCGTCTGCGGAGTCCATGGCGGTCTTCGCACTGGGAACGTG
GCTTCAACACATGTGCCACACCAACTAACCATCCAATATCATACCTGTTCTTCAACTTCATACCGGTAGTAGCCCATCGAATCTCGTACCGGTACCCACA
CTTTCCAACGTCATATTGACCCCAAAATGGACGTTAAGGGCATCGCTGCCAAATACGGCGGCTTGCCGGCGCGACTGGTAGCGCGCGCCGAGGAGAACCT
GCGGGTGACACTGGCCAAGAAGTCGGCGGCGCTGGACCCTTTTGCTGGGCCTGTGGCCTGTATTTTGGTAGCTGCGCGCGCGCTGGACGAGCCGGTGGAC
AGGAACCGCCTGGCGAAATGCGCCAGCGCCAACAAGCGTCTCGTGGAGCCCACGGTGCGCAAGGTGATCGATGCGGTGGGCGTGCGAACAGTCGTCAAGA
CGTCGCCCGCCGCGCTGTGCATCAAGTTTGGCTGCGAGGCGCTCACGGAGATCGTCGTGCGCGTGCTGGACGAGTACCGCGCGTATCTGGGGCAGGTGGC
GACGGTTAACAGGAAGAAGCGAGCAAAGCACCCGCTCGGTCCGGCAGTAGCGACTATGAACGATCAGGACCCAGTGTTTGTAGCGGCGTGCTTGTATGCA
GTGAGCAAGCAGGCCAAGGTGGGGAAGGAACGAGGTGCTGGATGGTCTTGAAGAATTACTGACGAGACTTTTGGTGTGTGCAGATGAATGTGAACCAGGA
CAAGTTGCTGGAAGCGGTGTGCGGGATTGTAGGGTCGTTCGAAGCTATTGTGTCTTCCATTGAGGTGGGTGGAGGTGCTGGCGGTGGATGTGGTTGGTTG
TTCATAGTTTTGCTGTTGCTGGATCTGCAGGCTCAATGTCAGTCTTCGCTGAGCGGAGCTGTCATGGATCGGAGGAAGCGACGTAATTTGGCAGGCGAGA
GAGCAGCCAGAAAGCTCTCGGAGCAGCATCGTGTAGAGCAGCTGGAAGGTGAACAACGTGTGAAGCGACAGAGGAGGAGGCTAGATGGAGAAGTGGAATC
GCCCCCACCGCGGACGTTAGCGCAGCAGCGGGTATTCGAGAAACTACGGGCGTCTCGTATGGGCGTCACGCCAGCTCAGAGCGCGGGCTCATCCAGGAGG
GGGATGGCGGTTGCTACACCCGAGGAGTATGCTGAATGGAGGGCAAACGCACTAGAGTTCATGCGCAACAAGAAGAAACTAGAGAAGGTGAATAGTGGAA
GTAGCAGTACAACAAACCCGCTGACTGTTGTGACATCAACCTGAAGCATCAAGCAGGCAACTAAAATAAATGTGTCAAAGCCTACTAAAATGCCTCACAC
TGCTGACTCAAGAAGGCAATAATTTTGTCTCTATCCATACCCCCTTTAGATGGCTCTTCCGTGTTAGTAGTATCGCTGAGCCAACTAAAGTTTAATCGCC
TTTGCGGCGGCAGGGAACCGCTTTGTGAAAGCATCATCGGGGCCCAAACGGAAGCTCCACTTTCGCGATTCTGGCTCCAGGACAGCGAACTCTGAATTTT
CAAGTATACAACCAGTGTACGAAATACAAAATGATTAGTGAACCAAGGATTACACCACAGCATTGGTGTCCCTGTGAGCTGCAGTCTGGGAGCCTTACCG
CTCAAAATGGTCTTTGCAACGTCAGCATCCAAAGAGAACTTTTCCACCAGGTCCATTCGCGACACGCCCGACGGTGTCTTCGCCAACTGCAGAAAAACGA
GCGTGAGTTCCCTCCGAATGTGTAAACAAAGAGATACCAAAAAGCAACATACCGCCTTGATAATACTATCGCGAGCGCGCACCGTCGCCTCTCCGCGGCA
AATCAACGCACTAGAGGGAAGAAG