Description :
From Genome Similarity Track
Location :
Scaffold_532:4737- 6959
Transcript NameFunction/comments
Phypl_g9190nicotinate phosphoribosyltransferase, Zn-binding site
Phypl_g9191hypothetical protein

Sequence
2222 bases(100 bases per row)
gcagcttcttgtcggcgcccgccgccttcttgaagCGCGTGGCGTTCGTGGTGACGAGGCTGGCGAAGTTGAGCAGgttgagcagcggcgtctccagcag
ctgacCGACGGCCAGACTGCCCTCGATGCGCACGAGCGGGATGCGCGGGAAGACGATGGAGCCTTCCTTGATGGCGTACACcttgacgctggagcagtcg
AGCACCGAGAGCCAGTGGAAGAAGCCGTCCTCGGCGTGGggcagcacctcgcgcaggTACGCAATGTCGCTGGGCGTGAACTTGAACGTGTTGaccatgg
ccagcgcctcctccaggCCGGCGAACACCGTGTACTCTCCGTGGAACGGGTTCTTGCGGAAGAACAGGTCGAACACGGCGTGGTCGTTGTGGCGCCCCAC
CTTCCAGTACGCGTAGACCCTGGATTGGTAGAGCAAGAGGGGGGTGAGGTAGGGCGCGAGAGAGCTCGAGTagagcgccgacgccgacgtaCATGGTGAT
CTGGTACAGGTCGGTGAGCATGGGCCCCACCAACGAGTTGGTGGGCTCGAGGACGTTGCCGTTCATCATCTTACGGGCCGACGTGGATCGGGGGCGCGTG
TTGTCGAGCAGCTAAATAGCTAAGTGGAGGTCGAGACCACGTACGCTGAAAAAAGAACCTACAGTGTGATTTAGACTTGTGGTAGTTGATGCCGTGCCGA
CAGCCGCTCAGACAGTGGATGGCTCGAAAGGCATGTGCCGCATAAGCTATATCCCGTCCAACATGATATGGGAACATCCTGCCCATGCTGATATCATGTT
TGGAGGGTGCGAGGCTTGTTTGCTTGCGCATGTCACATGTGATGGCCGCCGAGAACGTGTCGTCTGCGCGCACCACTCAAGCGCTTCAAAGAAGATGAAA
AACATCAATCGGCGAGGCGATGGCCCTGAAACATGAGGGAGAGGCCTTGACCGTCAAGTTGACGACACCAACCTCGACAGCCCTGAGCCAACCATGATTG
GCAGTGAGTGACTTTCGTTGTCGTTGACGTGGCATTGACCGCATAATCCGTGCGATTAAAATCACACGGATTTAaaactagggctacgcgaaggctaGGA
TAGCGGATCCTATCAAAGAGTATCAGTAATTGCTGGCCGCACTGTCCGTCTGCGACTTCAGTTACTGTATCCGGGCTTCAGTAATACCGGCTTCAGGTAC
CGGCTTCAGTTACCGGCTTCAGTAACTGGCGCGAATTAACCTGATTTGGgctggacagcagcaaccttACAGGCAACTGCTATCCCAGTAAAAAAACAAT
CCTGAGTCCGATCCTTGCCGCAAAGTTCTCGTACTGTACTCACCAGCACACTCGGAGCGGGTCGACTTGTCCGGTGTCTATAATACGGGAtgcgagctgc
cggcgctgtcaACATCGCAGGAATCGACAATCGCCACCCATGGCCACGTGAACAGCTCGAGTCCACGACGAGCCTTATTAACTGTAAGCACGGCAAAGCG
GGGAGATACATCCTTTCGATTGGAATGAGGTGGTGACAATCGGCTTTGCCAATGCAATGCTCAGTTCGTAAGAAGTCGGTCGCGGCTCGGACACCGATAC
ATGTGCTATACGTTACAAGTTGTCGTGGGCAAACCATGTCGTGGTACTTCAACGAGGACACGATGCAGCAATGCAATGATGCTCGGGCAAACTGCTGTCG
TGGGAGCCACTCGAAGCGGACAGTGAAATCGACACCTGAAGCGATCATTTCACCAATGCAGCTATGTCACCGTAGATTCTATTGAGCAAACCAAAAGAGC
ACCCAACCTagatgcagaagctcgtACTGCAGCAGAATGACGGTCTCAAGAAACAAACTCGCTTGGTCCACATAGGTCTTTGCCTGTGGTACTTTGAAAT
CGCATTTAATCGAGGTGATCCGGTATCAATGGTACCGAATCTCAACATTTGGGTGACGCAATATGGAGggtggacgcggaggcggGCGAGGCAAaggcaa
gaagggcaagaagaaggtggcggcggctgctgctgctagccACCTCAAGACGGCCAGCCACCCCAACGTGCAGGTGGCCTCTGCGTCAGACGCGGCCGCT
GGCGACCAGACCATGACGAAGTCCAAGCGCAAGCggctgaagaaggcggcggccgctgAGGCGGTGAAGGCCGCGCAGCCGCACGTGCAACAGGCGAAGA
AGCCCCCGACGGCTGCCGCGTC