Description :
From Genome Similarity Track
Location :
Scaffold_80:4736- 6206
Transcript NameFunction/comments
Phyca_LT1534128969Hypothetical protein

Sequence
1470 bases(100 bases per row)
tcctttttccctggacaacgattggctggtagatctgtcgtcacaactatcaggtttttcttttgcggaataaatgcaataaggagagtaccgtagcata
catggcctctcggactgtgtgacacacaccaagaatcgttcttcaattgtccagtaacgcaacaaaggcatgagcactgctcagagcagagctatatgtg
cacgtggaaatgatgcagccgcgttagcatctactacagcgctgcaaatcttcgtcgaagatcggcgttagctggccaagaccaagggcgagatctaaag
cacatagaactactccataacgatcgcacaggctactaccaaagcgctcacctatcacacgcctgtctcgtttttggctttgccgacgctcgtttatcaa
tctgatagggccacggttcctgacctcactgaagcacgacgtgactagttagcatccaggtagtacgtactcatcgacctgaacgatagaacttgtgtat
aatacgcaacaaaacttcgaagcttcgaaggcagctgcttcaagggccaggtctgacttgctctggggctttcattttcagtccagatttcggcgccccc
agtgaagatggattcttcggagctagacgactcggtcgccgttctatttgctaattcacgcatgtagtcccgcgaatgacagtgcattgtgtgccaatca
gctacctgccccagaggagatgctgggctggcataggggaggtgacgtcgacatcaatacggtgggtgtgttgtgagctcattatttgaatatctaagta
attggtatttcccaggcccttgagtacttcactgccggcaccagccaacctattgcattcgacaatttgtaccctgtgacctactcgtttatccccgtag
tatgttatttggctttgctggtcagtggtcatgtcctcactgacgaaaacgctttggtatttaggagcgcgagcgcagttttggctcttacgccggaatc
gatgatttcatcggtgctctccctgtaaagcaaatgtacaatgtttatgcagggctgtttaccggcaatcatgaatttcgtcacgaatacatctttatgc
tgaagtggcttagagactccatggagatgtcagatgtacgacgttgttattagtttttggaataagttattcatcctgtctatatttgttatctatctag
attatttgtagccacctcgctgatcgcctgaatttcttgaaaatctacctccaatatacgcaaacgaagatcaaagagcactacaagcgctacaaagata
tgaaggcggacgagtctgttactgacgagaccgtatatctccacaagaaggaagggtttcacaagaaacgtggctacgatattttcgtgtatctgagcat
ggccatgaccgtcatcaacgtatttgcgaatcaaactgacaagcctcaatggcagcaatgccaatgcacc