Description :
From Genome Similarity Track
Location :
Scaffold_130:4736- 5745
Transcript NameFunction/comments
Phyta_totarag4208hypothetical protein PHYSODRAFT_496021

Sequence
1009 bases(100 bases per row)
TGCACGCGCAGCTCACGCGCTTCGCGTCGCTGCCCGACGCCGAGATCGTGGAGCTCCTGCGCGTCCTGTCCGAGTTCCTCATCTACTCGGACCAGCACCG
CGTGtccgtggagctggaggaccaAGCAGCCgccgactcggacgacgccgCGGACGACgccggcgccttcttcgactACTTCGGAGAGACCAACatgctc
gcgctgctggtggagctgggcGCCAGCCAGCCGTCCGTCCCCGTGCAGgtacagctgctgcagacgatgagCATCTTGGTGCAGAACATCGCCACACGCA
CGTCGCTCTACTATATTTTGAGCAACAACCACGTGAACCGCCTGCTCGAGTGTCCCTTTGCAGTGGagagagacgacgacgtgcgaGATTGGTACGTCAC
CTTGCTGAAGGCCTTGTCCCTGAGACTGAACGAGGAGACGGTGCAGTTCTTCCTGGACACACAGCAAGGAGAGAACTTTAGCTTCCCGCTGTATGCGCGG
GCACTGAAGTTCGGACGGTGCAATGAGACGATGGTCAAGGTGGCAGTCAAGACGTTGACGCTGAACGTGCTGAAAGTGCCAGACGCCAGAGTGCGGCGGT
TTGTGCTGCAGTACGACGACTTGAACTACTTCCGAGATATTGTGGAGATCGCCAACGACCTGACGTTGACGCTCCAGGGACTGCTGAACAATTGGCCTTG
TTCAGAGGAGCAGGCGCAGAGGACGGCGAACACGGAGAAGTTAGAAGAAACGGTGGACGCGTACATTGACCACTGCTTCTACCTGCAGGACCTGCTGGAT
GTGAATGTGCCGGAACTCTGTTATAAAATCGGAGACCTGCTCTTCTCGCGACATATCAAGTGCTTGTTGGCGACTAGCATACTGCCTGACTGCGGACCCC
CGCCGCAACGAGTGTCGACGCAGCTGGCGCTCTACCTGCTCACTAGACTGCTGGGTATTTTGGAGCATACACCTCTCGTGAATGCTATCGCGTTtatgtt
gctgtcgtc