Description :
From Genome Similarity Track
Location :
Scaffold_30:473531- 479174
Sequence
5643 bases(100 bases per row)
TGCGCTTCCTCATCACTACGTGTAAGCAAGTAACGGACGCCCCAGGCCCGTTACACCTGGTAGAACTTAGTAGTCCTTCCCATGACCAAGTTCACGATGA
GCCTAGGCATGACGTCTGAAACTCCAGGGCCGACCCTGGAACATGATGCTTTCCCTCATCTCACTCGTGTCGAGTGGGAAGCCCTTCACCGCCTCGCGGC
GGTGTCTGGTGAGGCTGTAATCGCGTCGCTGCTGAGCTCAGCGGCGTCCGACCAGAACGCGAGCTAGCCGATGCGAATCGGCGAGCAACAACTCCCGCGC
GTTCCTCGAAAAATGATGTCGTGAAGCTAGAGACGTCTACCTACTCCGGTGAAGGAGCGAATCGCCTCCCGCTGAACCGGTGGTTTCGCGAGGTCGACAT
CGCGATTGCTTCGAGAATGATCGAAGCGCAAGGGTCAAAGGTCAATTTCTTATTGTCCCGGTTGTCCGGGAAGGCCAAGGAATGGGCCCTCGGTAAACTT
GTCGTTGATCACGACGCATTCTCCACTCTGGAGTCTCCCCAGAAAGATCTCAGGCTCGCGTTCGAGCCCTCTCAAGACGAGTCCCGCGTGCGTGCCGAGT
TCTTCGCCCTTCGTCAAGGTAAAAGGACTATGCGCGACTACGTTCAAAAGACTCGCCACCTCGCGTCATGCATCGTGACAAATCCGATTGACACAGCAGC
GCAGGTCCATGTATTCGTATTCGGCATGCGTGAAGGTATGACACGGTACTGCCTGACCCGAGCGGAACCTTCCTCTCTCGAGGAAGCATTCGCCCTCGCA
TTACGCGAAGACTACGTTGTGGCGGCGTCTTACGCGCGCGCGATGTCTACGGCAGCTCGTGAGTCAGCCCCCGAGCCCATGGAGATCGACGCGATTGACG
CGTCGAATAGTCACCGTCAGTAGACTCCTCGTGGGCCCAACGGCCGTCCTAATCGCCCGATCACTTGCTTCCGCTGCCAGAAGATCGGTCATCGCGCGGC
GGAATGCCGCGCGCCAGCGCCGGTACTCGCGCACCCCACCGAAGTCTCACCTGCCGTTCAGTCAAAAAACGGTCAGGGCCAGTAGGTGCGGGGCGCCCTA
CTGGCTGGAATGGAGGTCCGGGTCCCCCGGTGGCTACCCAACCTTCTAGCCATCCTGTGCTCCACGCACACTTTAATGCCACCACCACGTCGGGCGACTC
GAGGCTGATCATCGTCAGTCTTCATGTCGCCGGCGCCCGGCGACCACTTCGCGCACTCCTGGACTCAGGAGCGTCAAATAACTTCTTTCGTGAATCGTGC
TTATCGATGTTTCCAAGAGAGATCGCAGTCCGTAATGGTCGAGGTCAGGTCGTCGTCAAACTTGCTGACGGAAAGCCACGCCGCGTTGCGCGGCGCGAGA
TCACGTTGCCGTACACATTCGACGGCTTCCGCAGCAACGACGACTTCCTCGTGATTGAGATGGACTACGCGTTCGACTGCATCTTGGGTATCCCGTGGTT
GTCACGATATCAACCAGAGATTGACTGGTTGGCTCGGTCGGTTAAACACCGCTCTGGCTTCGATGTGAGTGAGGTGCTCACACACCTCCTGGTTGCCCAG
AAGGACTGGCCCCATGTCAGGGTCGTGGACCGGTTGTCCACAATGCAGGTTGAGCAGAGAGCGAGCGATGGCCCTCTCTGTATGTCTTGCACAGCGCTGT
TGCGCGAAAACCCCTCGCTGCGAAGCGAGGTTGTTAACACTTTGGCGGTAGAGCAGGGGCTCCCGCAATCCGAGCAGGCGGTCGAGCATGAGTTCCCGTC
ACGCAACACGGCGGTCGAGCATGCAGTTACCAGTCACGCAACACGACGGTCGAGCATGAGTTCCCGTCACGCAACGCGACGGTCGAGCATTGGTTCCCGC
AACACACCAAGGCGGTTGAGCATGGGTTCCCGCAAAGCACTCTAGCGGTTGAGCAGAGGTTCCCGCAACGCGATTCGGCGGTCGAGCAGTTGGAGCTCCC
GTCATCCACAGCGGTGGTCGAGCAGTTGACACTTCCACCAGCTACGACGGCGATCGAGCAGGGGCTCTCGCCAGTCGATGGCGCGGTCGAGCATCGAGAG
CTCCCGCGCACTACCGACACGGTTGATGGTGCCCCTCCGTGTCTAGGAGGGGGGTGATCCCTCGTCCAGCGATAGCGAGTCTTCTATCTCGAGCAGCGGA
TCGAGACGCCCCAAGAAGAAAATCCAAGCGACGCCCGTCCTTAAGCGACGTGGTCAAGCCACCGCCGATATCGCAGTGAATGAGTCCATACACGTCCTGG
AACACGTGGAAGGAGGCGCCGTTCGCTCACGCACACTTGACATTGAGAGTCCACCTCGCGAAGCTTCTTTCATCACACGCCTTCCGGGTCTTTCCTGGAA
GCATTTTCTGCGCGATCTGAAGTCAGGAGACATTGAGCAGGTCTGCTTGATCACCGAGTCTGCCTCGGCGGAAGAGATCCAGACGGTCGCTACCGACAAT
CTTCCACTTCGTCCAAAGAACGCTGAGCCGAAGTCGGCGCGCGAAGAGCGCTTCGCTGCCCAGTCGTGGGAGTCACTCCGCGACTCGGGCAATCCAGTAT
ACGACACCGTCCGCGAGTTCGCGGATGTTTTCCCGACAAGATTCCAGCTGAGCTCCCTGCTGACAGAGTCATTCGCCATGAGATTGATCTCACGCCGGGT
TCCAAGTACTGTGTGACGCGACAGTGGCCCCTCCCACGCGATCAGGTTAAAGCCATTGACGACTTCTTCGAGAGCCGCCGCAAAGCGGGTCACGTGCGCG
AGAGTACCTCGCCACACTCAAGTCCGACGCTCTGCGTGAAGAAGGCCACGGGTGGTTGGCGCATTTTTCACGCTTTTAACAAGCTAAACGACGCCACCAT
TCCAGCACAAACGCCGATCCCTCGGAAGGATATGGTACTTGACACCATGGGCCGCAGTGTTACTTTCAGCACCATCGACCTGACCGACGGCTTCTATCAG
ATCTTGATGCGACTCAGCGACGTCCCGCTCACAGCGGTGAGCACTCTCAGCGGGATGCTGTGGGAGTGGCTTTTCATGCCGCAGGGCCTGAAAAACGCAC
CAGCCACGTTCAATCGCATGATTTCCCACGTTCTGCGCCCACTTCGCGACTTCGCTCCGAGCTACTTCGATGACATCTTCGTTCACAGCCGCGCTGAGGG
CGATCTCAGTGCCACAGAAGTCCATTTAAATCACTTACGACAAGTGTTCCAAGTCATGCGCGAAAACAAACTGTACGCGAACTTGAAGAAGTGCATCTTC
TGTGCCCCGGAGATTCCGGTGCTTGGCTGTTATGTGAGCAAAAATGGTGTCCGAGCGGATCCTGAGAAGGTCTCGTCCATCTGTGCGTGGCCCACGCCGC
AGAATCAGACTGAATTGCGTCAGTGGCTTGGCCTCGCAAATTATCTCCACAAGTACACGAAAAATTATGCTGGTCTGATCCAGCCATTGTCTTCATTGCT
GAAGAAAGACATCACGTGGTCGTGGACTCCCGAACATCAGTCAGCCTTAAATGCAGTGAAGAAAAGCTTGGCGGAGGCCCCAATCCTGGCGCTTCCAGAT
GATGCAAAGCCATTCCACGTTGTTTGCGACGCGAGCGACTTCGCCATCGGCTGTGCACTGATGCAGTTCGACGACGAAGGTCGCGAACGCGTCGTGAGCT
ACCAATCCAGACAGATGAAGCCCGCTGAGAAGAATTATCCGGTCCACGACAATACGCACTGATCAAATTCAGAGTGTACTTTCTCGGTGAGCAGACATTC
GCGATCTACACAGATCACGCGTCGCTGCGAACAGCGACGAAGAGCCCTCATCTCTCTCAGCGCATGGCACGATGACTGTCATTCTTCTCCGAGTACAACT
TCGTCGTTCACTACAAGCCAGGCAAGAATAACATCCTTGCGGATGCCCTATCTCGGCGCCCCGATTACGATCCACGCCGAGATTTGGGTCGTCAGTCACT
TGAAGACGCGGACGACGACGAATTGGACTGCGCCACATGTGTGGCTGCAGGTGTGAACCTGATGACGGCGGTATCTCCAATACTTCCCCTGCGGGAAGAG
ATATCTGCCGCGTATCGAGATGACTCGATATATGCCGGTATCCTGGAACGCCTTCGCACACCAAGTGATGCCACGCTAAAGACACTGAGCCGCTCCACGC
GCGACCAGATTCACAGATACCAACTTGACGGTGATCTACTGATGTACAGTATCGATCGATTCGATGCTCCTCGCGTCGTTGTCCCCAACGACCCCGATCT
ACGCGCAAGAATTATACACGAATTCCATGACGCTCCAGTGGGTGGCCACTTGGGCCGTGAGAAGACTTTCGCAGCGGTATCCCGCGATTTCTACTGGCCT
CATCTATACAAGTGGGTGCGCAAGTGGGTCCGCTCCTGCGAGACTTGTCAACGCGTTAAGCCGTCACCGTCATCGCAAGCTCCGCTGCGTTCTCTCCCTC
TGGCGACAGAGGCGTGGCGCTCTGTGTCAATGGACTTCATATTCGGTCTCCCACCCGATACTGACGGCCGAACTGGTGTTCTGGTCTTCGTGGATCGCTT
TAGCAAGATGTGCCATCTCGTTCGGTTCCGGACTCAATCACCGCGGCCGATACCGCGGTGCTCTTCGTCGACGCTGTCTTCCGACATCACGGCCTTCCTG
AATCAATCGTCTCTGACCGCGATCCCCGATTCACATCGGCGTTCTGGACGAAACTCTTCGACCTCCTGGGCACCAAACTCCTCATGTCGACGGCGGCGCA
CCCGGAGACGGACGGGCAAACGGAACGCGTCAACCGCGTGCTAGAAGATGTTCTGCGCAGTTATGTCCCGTCCTTCGAGAACTGGAGTTCCTTCCTGCCT
CTTGCGGAGTTTGCACTCAACAATGCCGAACACGCGTCGACGGGATTGACTCCGTTTTTCGTCAACAGCGCGCGTCATCCACGTGTCCCCGCACAGCTTG
CTGTGGGCCAACCCACGGCGACTGATGGCTTCACTCTGGAGGAAGAGGAATGTGATAACCCTGCCCAACCGGTTCCGATACTGGTTCAACCACCGGTTTC
CGGTGAGACAACGGTTCTGCCGTCTACGAGTTCAGCTACTCCTGCAGTAGACATCAACGCGGTGACGCGTTTACAGTCGAAGAAGATCCTCGCACCCGCG
CAATCCACGTCGTCGCCGTTAGTTGACTGGACACACCGAACGCTGATCGCTCCAGCACAGCCACACTCGACTGTGGCTAACTACGCGCCGAAACCTCCAG
CGCGACCTGCTGACAAGGCAGCGGTATCCGACTTTGTCCTTCATCGCCAATCGGTTACCCGATTCGTCCGTGACGCGCTACAACTCGCGGTTGACAAGCA
GAAGGAAAACGCTGACAAACGTGGCCGCAAGAACACAAGTGCATTCAAGATTGGTGAGCGTGTATTACTCTCAACGGATGGAATTCGTACCTCTGCTATT
ACGAACCTAGGCGCGAGCAAACTCGCGGCGCGCTACATTGGGCCATTCAAAGTACTACGAGTTATGGGTGATGCCTACACGCTAGACATTCCTACGTCGC
TACGACTACACCCGACGTTCTACGTCGGGCAACTTAAGAAGTA