Description :
From Genome Similarity Track
Location :
Scaffold_116:47342- 50001
Sequence
2659 bases(100 bases per row)
TTTCCTCCTACCCCACACCCTTTCTGTGGATCCGCCTTCTCTTTCTTTTCTAATATGACCAGCTCACATCAGAGATCCTTCTCCTCCTGGCTCACACCCT
TTCTGTGGGCCCTTCTTCATCCTTCCATCGATATGACCCACTCACACCCATGGATCCTCCCCTTACTCCTCTTCATGAGACTGCATCACGCCGAATCGGT
TCCGATTCGTACGATCCCGCAATAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCAACTGGGTTCGTCATATTCACGCCAATACAC
CAAAAATTTGCGGTAAATTCGTCCTTTTATGACCTCATGTCGGAAATCTTCTCGACTCCGAACTCGTCGGCTTCGAGATCCACGTTCCAACTATCCTCCG
GTAGGAGGACTTCGTCGAAATCCACCCGGTTGGGCTCATCCACCGAAAGACGGATTTGCGGCCGGTCCGGATATTCCTTGACCAGCTTCAGCTTGGATAC
GTGTACCACTGGGAACAAGTGATATTCGGTACCTGCCGTTTCCAACTTCACAGCATGTTCCCCTATCTTCTCACTCACTCGGAGCAGTCCATGCCATAGA
TGGGCCAGTTTACGGGCGTATCCTTCCTTCACTCGATCCAAGTACAGCCACACTTGCGATCCAACTTGGATTTGATGTGGTCGAGCGTCTTCGTTGTGTC
GATCCGCTCGATCCTGTATCACTCTTCGTAACCGTTCGTTCACTTGGGATCTGGCTTGCCGGAAGTACTTCTGGACTTGGTATCGCCATCGTCTTAGATC
TCGATTCCTTTTCTTGGTGCTACATACCGGAATGGCTGCTTCTAGGGTGGATTTAGGATCCCACCCATGTACCAAGTAAAATGGGGTGTCACCCCGGACC
CTGTCTTGGGCGGTGTTCATCGCGAAGGTGAGACGTTCTGCGTACTCATCCCAATCCCTCTGATCCAGATCCTGAACATACATCTTGAGCGCCCTCGTGA
TCGTCTGTACCATGCGTTCGACCGATCCATTGGCTTGGGGACGATATGCCATAGTCGCCCGCTGTCTCTGCCCCAGGATCCGGTTGAAGACTCGAAAGAA
ATCAGACATAAAGCCTGGATCCCGATCATGTCGAATCATTTCACTAGCTCCAAATCTCCGAAAAACACACTCCTCGTACGATTCGTCGATGGTTTGTGTA
GTTCTGGACGCGCTAGCTTTGGCTATCACGTATCCGGTAAACAGATCCACCCAGATCAACAATTCTGTGTTTCCTTTGAATGACTTGGGTATCGAGGGGA
TATGATCCATGGCTATGATTTGGAACGGGTAAGTCACCTGGACATTCCCCGGAGACTCCCCTTCAATTGTGGGTCTGCCCTTGCCTGTCTCACAATCCAC
ACATTCACCTACATATCGTTGCACACTCTTGAATAATCCCCTCCAGTGGAAACATTCTCGGATCCGTTGGTAGGTCCGACCGATTCCGTAATGTCCACCT
TCTAAACTAGCGTGATAGTGATGTAGGACATCCCGTTGCGAGGTTTCCGGCATCACCAATCTCATCAATCCGTCTCGTTTCTCGCTGACTCGTTTCGTAG
GGGACAATAGAAGAGCAAATCATTCAGATCCATTGCATAATCCGTCGCGATATTACTGTAGAATTTGGCGTTCTCCCGACTCAGGTCTCGCACATCCCCC
ATCAGATACTTCTTTAGCCCCAGAATCCACACTTCTTCGTTCTGTGCTTTGAGAATCCGCTCAATACGGACTCCCTTCACAAATGCTTCATATAGGATCT
GGGAGCTGGATCCAATCCTTCCTCTGGACCTAGTGACGGCCATCACCTGGACTGTCCTTTTCCCGGATCCAACCACCACCACTTCGTGTAGTCGGTTTAA
CGTGACGAGATCCTGACGCTCGGCCTCACTCTCCACCGCAACGCCACATTGACTTCGTAAAGCGGCACTTGCCAAGCTGTCAGCACTGGCATTCCAATCT
CGCTTGACATGTACCAGATCGTGATTCATCCAACCACGTAGGTGGATCATCATCTTCTGCCGTAACAGCGTTAGGGCTGGGGCCTTGCAGTCAATTTCGC
CTCGCACCTGTCTGATCACCTAATTCGAATCTCCACATATCACCAGCCTTTTCGGATCCTCTTCCTTTCATAGATCCAAACCCAGCAGGAGTCCGTTATA
CTCCGCTTCATTGACGGTGAGGCCTTCCGCGTAAGTGGATCTGGTCCATACAACTTCCCATCCGGGCAGTTTCCACAGTATTGCGCTGTATGCTTCTCCT
CCGCGTCGCACGCGAGCAGATCCATCGAAACTCAGGACGTACAGATCCTCATCCACTTGTACCGTCGAGATTGGGATCTGGATCCGGCGTTTGGGCTCTT
TCTTAGGAGCGATCCTAGTCAGTGCTTCGTCCATCTTGGCTCTGGGCATGATGCTCGCGGCCAAAACTCCCAGGATCTCGTCCTCTCCTTTCGAACATTT
TACGATCTCCAGTGTCCAAGGTGAGAGTAAAGCTGCCCATTGTCCCAACCGTCCTTGTAGACCGGCCGACTTGAACAGCCAGGCGAGCGTGGCGTGTCGA
GTCAGGATCCGGATAGATCTTCCCAACAGCAGGTTATAATTGAGATCCAACACCCGCAG